ID: 1066442023

View in Genome Browser
Species Human (GRCh38)
Location 10:35448611-35448633
Sequence GTTCAGCTCTCATATCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 158}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066442023_1066442031 18 Left 1066442023 10:35448611-35448633 CCTGAAGGATATGAGAGCTGAAC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1066442031 10:35448652-35448674 AGGAGCCTTCCCAGCAGAGTGGG No data
1066442023_1066442025 -7 Left 1066442023 10:35448611-35448633 CCTGAAGGATATGAGAGCTGAAC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1066442025 10:35448627-35448649 GCTGAACCATGTGACTCCTTGGG No data
1066442023_1066442027 -2 Left 1066442023 10:35448611-35448633 CCTGAAGGATATGAGAGCTGAAC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1066442027 10:35448632-35448654 ACCATGTGACTCCTTGGGGAAGG No data
1066442023_1066442035 29 Left 1066442023 10:35448611-35448633 CCTGAAGGATATGAGAGCTGAAC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1066442035 10:35448663-35448685 CAGCAGAGTGGGCATGCGCCTGG No data
1066442023_1066442026 -6 Left 1066442023 10:35448611-35448633 CCTGAAGGATATGAGAGCTGAAC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1066442026 10:35448628-35448650 CTGAACCATGTGACTCCTTGGGG No data
1066442023_1066442024 -8 Left 1066442023 10:35448611-35448633 CCTGAAGGATATGAGAGCTGAAC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1066442024 10:35448626-35448648 AGCTGAACCATGTGACTCCTTGG No data
1066442023_1066442030 17 Left 1066442023 10:35448611-35448633 CCTGAAGGATATGAGAGCTGAAC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1066442030 10:35448651-35448673 AAGGAGCCTTCCCAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066442023 Original CRISPR GTTCAGCTCTCATATCCTTC AGG (reversed) Intronic
903871476 1:26438121-26438143 GAACAGGTCTCATATTCTTCAGG - Intronic
904164652 1:28546105-28546127 CATCAGCTCTACTATCCTTCAGG + Intergenic
905070580 1:35221526-35221548 CTTCATCTTTCATATCATTCAGG + Intergenic
906321986 1:44822783-44822805 TGCCAGCTCTCATATCCTGCTGG - Intronic
908862536 1:68506051-68506073 AATCAGCTCTCATTTCCTTTGGG + Intergenic
915678708 1:157558242-157558264 GTTCAGCTCTCATATAGTAGAGG + Intergenic
917072368 1:171166194-171166216 TTTCAGCTATCATTTCCTTGTGG - Intergenic
917072370 1:171166223-171166245 TTTCAGCTATCATTTCCTTGTGG - Intergenic
918069253 1:181122935-181122957 GCTCAGCTCTCATCTTCTCCAGG - Intergenic
918437007 1:184525607-184525629 GATAATCCCTCATATCCTTCTGG - Intronic
919267548 1:195290483-195290505 GTTCAGGTTTCATCTCCTGCAGG + Intergenic
919443222 1:197666691-197666713 GATCTTCTCTCATATACTTCTGG + Intronic
920284501 1:204870050-204870072 GCTCAGCTCTCCTACCCTCCTGG - Intronic
1062938075 10:1402652-1402674 CATCAGCTCCCATCTCCTTCTGG + Intronic
1064706934 10:18082664-18082686 TTTCTTCTCTCATATCCTTCTGG + Intergenic
1066442023 10:35448611-35448633 GTTCAGCTCTCATATCCTTCAGG - Intronic
1067299036 10:44992848-44992870 TTTCAGCTCTCAAATCTTACGGG - Intronic
1067493303 10:46735786-46735808 GTACAGCTATCAAATCATTCAGG - Intergenic
1067601358 10:47604618-47604640 GTACAGCTATCAAATCATTCAGG + Intergenic
1068238568 10:54272315-54272337 GTACAGCTATCAAATCATTCAGG + Intronic
1069274634 10:66574340-66574362 GCTCACCTTTCATATCTTTCTGG - Intronic
1070328889 10:75404415-75404437 GTGAAGCACTCTTATCCTTCGGG + Intergenic
1071092045 10:81930202-81930224 ATTCAGTTCTCATAACCATCTGG + Intronic
1071652904 10:87412490-87412512 GTACAGCTATCAAATCATTCAGG + Intergenic
1071660940 10:87502236-87502258 GATAAGGTCTCATCTCCTTCTGG + Intergenic
1076335488 10:129703817-129703839 GCTCAGCTGACATCTCCTTCAGG - Intronic
1079617108 11:22508987-22509009 GTTCAGCTCACATGTTCTCCTGG + Intergenic
1079689290 11:23402352-23402374 CTTCATCTCTCACATCCTTCAGG + Intergenic
1082208970 11:49473890-49473912 GTAAAGATCTCATATACTTCTGG - Intergenic
1082676364 11:56109608-56109630 GTTCATCTCCCATTTCCTTTTGG + Intergenic
1084916088 11:72430031-72430053 CTTCAGCCCCCATATCCTTTGGG - Intronic
1086640647 11:89151339-89151361 GTAAAGATCTCATATACTTCTGG + Intergenic
1086738529 11:90338089-90338111 GATCAACACTCATAACCTTCAGG + Intergenic
1087973542 11:104515688-104515710 GTTCAGATTTCATCTCCTTCAGG + Intergenic
1088092272 11:106056845-106056867 TTTCTGCCCCCATATCCTTCAGG - Intronic
1089351931 11:117826287-117826309 GTTCAGCTCCCTTCTGCTTCTGG + Intronic
1094059677 12:26300480-26300502 GTCCAGCTGTCATCTTCTTCAGG + Intergenic
1096594175 12:52684095-52684117 GTCCAGATCTCATCTCCTCCAGG + Intergenic
1098377305 12:69830762-69830784 GGTCAGCTCTAATCTCCTTACGG - Intronic
1100660394 12:96691814-96691836 GTACAGCTCTCCTCTCCTTTGGG + Intronic
1101712973 12:107285929-107285951 GTTCAGCTCTTCTTTCTTTCTGG - Intergenic
1102166313 12:110809592-110809614 TTTCAGCCCTCATTTCCTTATGG - Intergenic
1103249135 12:119485031-119485053 CTTCAGCTCTCATCTCCATCCGG - Intronic
1105325819 13:19370055-19370077 GTTTAGCCCCCATTTCCTTCAGG - Intergenic
1108511122 13:51156769-51156791 GTTCAGCTCTCATGGGCATCTGG + Intergenic
1109248785 13:59992072-59992094 GTTCAGCTCTAATATCTTCAAGG + Exonic
1112688718 13:101864005-101864027 GTTCTGATATCATATCTTTCAGG - Intronic
1113061398 13:106325981-106326003 GTTCAGCTGGCACATCCCTCCGG + Intergenic
1115099653 14:29683352-29683374 GCTCAGCTCACATCTCCTGCTGG - Intronic
1116662550 14:47729789-47729811 GCTTAGATCTCATCTCCTTCAGG - Intergenic
1118940179 14:70327360-70327382 CTTCAGCTCTCAAATTCTACAGG + Intronic
1121783242 14:96636089-96636111 TTTCAGCTCTCAGCTCCTGCAGG - Intergenic
1127645543 15:60954815-60954837 ATTCAGCTCTCATTACATTCTGG + Intronic
1129595886 15:76963828-76963850 GTTCCTCTCTCATAGCCTGCAGG - Intergenic
1129595891 15:76963858-76963880 GTTCCTCTCTCATAGCCTGCAGG - Intergenic
1130300768 15:82678655-82678677 GCTCAAGTCTCATATCCTCCGGG + Intronic
1130486557 15:84401526-84401548 GTCCAGCTCTAACTTCCTTCTGG + Intergenic
1130848899 15:87774376-87774398 TTTCTCCTCTCATCTCCTTCAGG - Intergenic
1133048731 16:3104458-3104480 GTTCAGCATTCCTGTCCTTCCGG + Intergenic
1134352248 16:13448498-13448520 GTTCACCTCTTATCTCATTCTGG - Intergenic
1135845498 16:25914723-25914745 TTTCAGCTCTCATCTCCCTCTGG - Intronic
1136124456 16:28167554-28167576 ATTCAGCTGTCACCTCCTTCAGG + Intronic
1137983152 16:53086537-53086559 GTTCAGCTCTCAATTCCACCTGG + Intronic
1144188559 17:12821447-12821469 TTTCAGCTGTGATATCCTTAAGG + Intronic
1144516583 17:15921789-15921811 TTTTAGCTCTCACATCCTTAAGG + Intergenic
1146590160 17:34121885-34121907 GTTCAGCTATCAACTCCTTCAGG + Intronic
1150178809 17:63092331-63092353 CTACAGCTCTCATATACTGCTGG - Intronic
1156643576 18:39131891-39131913 TTCCAGCTCTCCAATCCTTCAGG + Intergenic
1158185268 18:54764283-54764305 CTTCAACTCTCATATCCATATGG + Intronic
1158384288 18:56971647-56971669 GTTCAGATATCCTCTCCTTCAGG - Intronic
1160527433 18:79545844-79545866 GTTCAGCACTCAGATCCCGCCGG - Intergenic
1160608028 18:80066776-80066798 CCTCAGCTCTCATGTCCTTTGGG - Intronic
1162944985 19:14037657-14037679 GTTCTGTCCTCATCTCCTTCAGG + Intronic
1166716802 19:44973593-44973615 GTGCAGGTCTCCTCTCCTTCCGG - Intronic
1167054955 19:47104506-47104528 TCTCAGCTCTCATACCCTTTTGG + Intronic
1167215939 19:48164639-48164661 GTTCAGCTCTACTGTCCTTGAGG - Intronic
925394770 2:3525358-3525380 CTTCAGGTCTCATACCCTCCTGG + Intergenic
925865609 2:8223600-8223622 GTTCAGCTCCATCATCCTTCTGG - Intergenic
926813101 2:16773882-16773904 GTTCAGGTTCCATATCCTCCAGG + Intergenic
926972411 2:18480129-18480151 GATCAGCCCTCAAATTCTTCTGG - Intergenic
928465071 2:31515767-31515789 GCTCACCTCTCACTTCCTTCAGG - Intergenic
930102213 2:47612159-47612181 GTCCATCTCTCAAATCTTTCTGG + Intergenic
931759014 2:65400130-65400152 GTTTAGCTCTTATATTATTCTGG + Intronic
932265418 2:70363589-70363611 TTGCAGCTCCCATGTCCTTCTGG + Intergenic
933486339 2:82929221-82929243 CTTCAGTTCTCACATTCTTCAGG - Intergenic
933700440 2:85251591-85251613 CTTCAGCTCTTATATCCAGCTGG - Intronic
937204749 2:120228305-120228327 GTTCAGGTGTCACCTCCTTCAGG + Intergenic
937581424 2:123493434-123493456 GTTGATGTCCCATATCCTTCAGG - Intergenic
940161237 2:150715907-150715929 TTTCAGCTCTCAGAACCTTGGGG + Intergenic
943674198 2:190700963-190700985 GTTCAGGTCTCATTTCCCTGCGG + Intergenic
944054410 2:195508552-195508574 TTTCAGCTGTCAGGTCCTTCAGG + Intergenic
944866381 2:203866539-203866561 GCTCAGCTGTCATCTCCTCCAGG - Intergenic
945048332 2:205801088-205801110 TTTCAGTTCTCACAGCCTTCAGG + Intergenic
1168863030 20:1059766-1059788 CTTCAGCTGTCAAGTCCTTCAGG + Intergenic
1169469666 20:5873000-5873022 GTTTAGCCCTCAAATCTTTCTGG - Intergenic
1172223125 20:33287170-33287192 GTTCATCTCTAAGCTCCTTCTGG - Intronic
1173925571 20:46778741-46778763 GTTCAGCTCTCCTGGCCTCCTGG - Intergenic
1174571284 20:51503577-51503599 GTTCTACTCTCAGATGCTTCTGG + Intronic
1174981055 20:55395382-55395404 GTTCACCTTTCATATCCTCCAGG - Intergenic
1179396364 21:41043862-41043884 GTTCAGCACTAACATCCTTGAGG + Intergenic
1184633591 22:45806647-45806669 GTTTAGATCTCATATCTATCTGG + Intronic
1184907848 22:47501129-47501151 GTTCAGCTCTCAAAGTCTCCGGG - Intergenic
949606566 3:5660081-5660103 CTCCAGCTCTCAGCTCCTTCAGG - Intergenic
950218693 3:11178225-11178247 GCTCAGCCCTCCTTTCCTTCTGG + Intronic
950574766 3:13825658-13825680 CTCCAGCTGTCAGATCCTTCAGG + Intronic
952428611 3:33200624-33200646 CTACAGCTCTCGTTTCCTTCTGG - Intronic
952463383 3:33553857-33553879 GTTCTGATTTCATATCCTTTGGG - Intronic
952465715 3:33583243-33583265 GTGCACTTCTCATATCCTTTAGG - Intronic
953407972 3:42669162-42669184 TTCCAGCTCTCCTCTCCTTCCGG - Intergenic
957323887 3:78667127-78667149 GTTCAGTACTCACAACCTTCTGG - Intronic
957553527 3:81736612-81736634 ATTTACCTCTCATTTCCTTCCGG - Intronic
959199763 3:103232079-103232101 TTTTAGCTTTTATATCCTTCAGG + Intergenic
961925398 3:130474125-130474147 GTTCAGCTCTCTTCTCCCTAAGG - Intronic
964517598 3:157529871-157529893 GTTTAGCTATCACTTCCTTCTGG - Intronic
965424802 3:168508839-168508861 GTTCAGCTCACATGCCCTTAGGG + Intergenic
969860613 4:10032743-10032765 GTGCAGCTCTCACACCCTGCTGG + Intronic
970171810 4:13298278-13298300 GATGAGCTTTCAGATCCTTCTGG - Intergenic
971368152 4:25994006-25994028 CTTCAGCTCTCAGATCCCTTAGG + Intergenic
973222012 4:47737377-47737399 CTTTAGCTGTCAGATCCTTCGGG + Intronic
978972333 4:114823975-114823997 ATTCAGTTCTCATAACCTTGTGG + Intergenic
979076237 4:116274816-116274838 GTGCAGCTCTCAGGTCCTCCTGG + Intergenic
986074030 5:4315943-4315965 TTCCATCTCACATATCCTTCTGG + Intergenic
986087761 5:4468705-4468727 GTTCATTTCTCATTTCCTCCAGG + Intergenic
987557525 5:19473516-19473538 CTTCAGGTCTGATATCCCTCCGG + Exonic
988442367 5:31247079-31247101 GTTCTGCCCTCATACCTTTCAGG + Intronic
990374057 5:55151761-55151783 GTTCAGCCATCAACTCCTTCAGG + Intronic
991286117 5:64978091-64978113 GTTCAACACTCCCATCCTTCAGG + Intronic
997753197 5:136369904-136369926 CTCCAGCTGCCATATCCTTCAGG + Intronic
998484456 5:142489542-142489564 GCTAAGTTCTCATCTCCTTCTGG + Intergenic
1003413213 6:5884312-5884334 GGTCAGCTCTCACAACCTCCGGG + Intergenic
1004955627 6:20724767-20724789 CTACAGCTCTCATAGCATTCAGG + Intronic
1005162809 6:22883977-22883999 GTTCAACTCTCATATCCTGAAGG + Intergenic
1006267408 6:32936720-32936742 CTTCAGCTCCCATCTGCTTCTGG + Intronic
1007643249 6:43360356-43360378 GTTCTCTTCTCATATCCTTTTGG - Intronic
1007736357 6:43984710-43984732 CCTCAGCTCCCATATCCCTCTGG - Intergenic
1008719783 6:54334851-54334873 GTTCAGCTTTGATATACTTTAGG + Intronic
1009646994 6:66417343-66417365 CTTCATCTCTCAGATCCTTCTGG + Intergenic
1012249171 6:96960782-96960804 TTCCAGCTGTCATACCCTTCTGG - Intronic
1012310851 6:97722418-97722440 CTCCAGCTCTCATATATTTCAGG + Intergenic
1014775574 6:125505461-125505483 TTTCAGCTCTCATTTCCATTTGG + Intergenic
1014843439 6:126246488-126246510 GATCAGCTCTCATCTCCCTCTGG - Intergenic
1018036900 6:159889455-159889477 CTTCATCCCTCATTTCCTTCGGG + Intergenic
1021473743 7:21036583-21036605 GTTCAGTTCTCAGAGCTTTCTGG + Intergenic
1029920015 7:104252966-104252988 CTTCAGCTCTCAGCCCCTTCAGG + Intergenic
1035341872 7:158167291-158167313 GTTTTGCTCTCCTTTCCTTCAGG - Exonic
1036544892 8:9758354-9758376 TTTCATCTCTTCTATCCTTCAGG + Intronic
1038683834 8:29696645-29696667 GTTCAGGTGTCAAATCCTCCTGG + Intergenic
1042868554 8:73377272-73377294 GCTCAGCTCTCATCTCTGTCAGG + Intergenic
1044002194 8:86897039-86897061 GATCTGCTCTCATATGCTGCTGG + Intronic
1044207173 8:89503980-89504002 GTTCAACTCTCAGTTCCTTGAGG + Intergenic
1044555972 8:93562485-93562507 CTTCAGCTCTGATAACCTTCAGG + Intergenic
1045761126 8:105609180-105609202 GTTCAGCTCTCATTGCCCTGAGG - Intronic
1047384136 8:124394097-124394119 ATTCAGCTCTCATTGCTTTCAGG + Intergenic
1050919596 9:11184958-11184980 CTTCACCTCACATATCCTTAGGG - Intergenic
1051161348 9:14211763-14211785 GTTCAACTCTGATTTCCTTTTGG - Intronic
1055431488 9:76248472-76248494 GTTCAGCTGTCATGTATTTCAGG + Intronic
1055901600 9:81245531-81245553 GGTGGGCTCTCATTTCCTTCTGG - Intergenic
1057544721 9:96009426-96009448 GTTCAGTCCTCCTCTCCTTCCGG + Intronic
1058044121 9:100337632-100337654 GTTCATCTTTCAGATCCTTTTGG - Intronic
1059699787 9:116764075-116764097 GGTCAGCTCTCTTATCCATGAGG - Intronic
1059911666 9:119051659-119051681 TTTCAGCTCTCATCCCTTTCTGG + Intergenic
1060198264 9:121636999-121637021 CTTGAGCTCTCTTTTCCTTCTGG + Intronic
1062001290 9:134217017-134217039 TTTCAGCTCCTATACCCTTCAGG + Intergenic
1185909049 X:3965581-3965603 GTTCGTCTCTCATCTCCTTCTGG - Intergenic
1187114015 X:16331077-16331099 CTTCAGCTGTCATTCCCTTCAGG + Intergenic
1190394176 X:49963005-49963027 TTTCACCTCTCAGCTCCTTCTGG - Intronic
1191921807 X:66264574-66264596 TTTTAGCTCTCATACCTTTCTGG - Intronic
1194983533 X:100465399-100465421 GTTCATTTCTCAAATCCATCTGG + Intergenic
1196390110 X:115198192-115198214 TTTAATCTCTCATATCCCTCAGG - Intronic
1198882042 X:141292288-141292310 ATTCAGCTCTCACTTCATTCCGG + Intergenic
1201277870 Y:12315319-12315341 GTCCAGCTCCGGTATCCTTCTGG - Intergenic