ID: 1066442028

View in Genome Browser
Species Human (GRCh38)
Location 10:35448633-35448655
Sequence TCCTTCCCCAAGGAGTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 311}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066442028_1066442035 7 Left 1066442028 10:35448633-35448655 CCATGTGACTCCTTGGGGAAGGA 0: 1
1: 0
2: 0
3: 26
4: 311
Right 1066442035 10:35448663-35448685 CAGCAGAGTGGGCATGCGCCTGG No data
1066442028_1066442043 27 Left 1066442028 10:35448633-35448655 CCATGTGACTCCTTGGGGAAGGA 0: 1
1: 0
2: 0
3: 26
4: 311
Right 1066442043 10:35448683-35448705 TGGTGGGTTTGAGGGGCAGAGGG No data
1066442028_1066442040 20 Left 1066442028 10:35448633-35448655 CCATGTGACTCCTTGGGGAAGGA 0: 1
1: 0
2: 0
3: 26
4: 311
Right 1066442040 10:35448676-35448698 ATGCGCCTGGTGGGTTTGAGGGG No data
1066442028_1066442042 26 Left 1066442028 10:35448633-35448655 CCATGTGACTCCTTGGGGAAGGA 0: 1
1: 0
2: 0
3: 26
4: 311
Right 1066442042 10:35448682-35448704 CTGGTGGGTTTGAGGGGCAGAGG No data
1066442028_1066442030 -5 Left 1066442028 10:35448633-35448655 CCATGTGACTCCTTGGGGAAGGA 0: 1
1: 0
2: 0
3: 26
4: 311
Right 1066442030 10:35448651-35448673 AAGGAGCCTTCCCAGCAGAGTGG No data
1066442028_1066442037 11 Left 1066442028 10:35448633-35448655 CCATGTGACTCCTTGGGGAAGGA 0: 1
1: 0
2: 0
3: 26
4: 311
Right 1066442037 10:35448667-35448689 AGAGTGGGCATGCGCCTGGTGGG No data
1066442028_1066442039 19 Left 1066442028 10:35448633-35448655 CCATGTGACTCCTTGGGGAAGGA 0: 1
1: 0
2: 0
3: 26
4: 311
Right 1066442039 10:35448675-35448697 CATGCGCCTGGTGGGTTTGAGGG No data
1066442028_1066442038 18 Left 1066442028 10:35448633-35448655 CCATGTGACTCCTTGGGGAAGGA 0: 1
1: 0
2: 0
3: 26
4: 311
Right 1066442038 10:35448674-35448696 GCATGCGCCTGGTGGGTTTGAGG No data
1066442028_1066442036 10 Left 1066442028 10:35448633-35448655 CCATGTGACTCCTTGGGGAAGGA 0: 1
1: 0
2: 0
3: 26
4: 311
Right 1066442036 10:35448666-35448688 CAGAGTGGGCATGCGCCTGGTGG No data
1066442028_1066442031 -4 Left 1066442028 10:35448633-35448655 CCATGTGACTCCTTGGGGAAGGA 0: 1
1: 0
2: 0
3: 26
4: 311
Right 1066442031 10:35448652-35448674 AGGAGCCTTCCCAGCAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066442028 Original CRISPR TCCTTCCCCAAGGAGTCACA TGG (reversed) Intronic
903016153 1:20363475-20363497 TCCCTCCCCAAGGAGGCAGCTGG + Intergenic
906473200 1:46148377-46148399 TGTTTCCCCAAGAGGTCACAAGG + Intronic
907877623 1:58508583-58508605 TCCTTCCCCAAGGAGTGGTGGGG - Intronic
910561718 1:88598600-88598622 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
910651711 1:89575236-89575258 TACTGGCCAAAGGAGTCACAAGG - Intronic
910831296 1:91464797-91464819 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
916094784 1:161339506-161339528 TCCTTTCGCAAGGAGAAACATGG - Intronic
918013962 1:180614920-180614942 GCCTTTCCCAAGGACTCTCATGG + Intergenic
918774310 1:188609364-188609386 TCCTTCCCCAAGGAGACCTATGG + Intergenic
919924119 1:202183471-202183493 TCCTGCCCCCAGCACTCACAGGG - Intergenic
920677649 1:208049171-208049193 TCCATGCCCCAGGGGTCACAGGG - Intronic
924665062 1:246063218-246063240 CCTTCCCCCAGGGAGTCACAAGG + Intronic
924946660 1:248851092-248851114 TCTTTCTCAAAGGAGACACATGG + Intronic
1063526643 10:6792948-6792970 CCCTGCCTCAAGGAGACACAGGG - Intergenic
1064517846 10:16169631-16169653 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1066053654 10:31660526-31660548 TCCTTGCCAAAGAAGTGACAAGG + Intergenic
1066442028 10:35448633-35448655 TCCTTCCCCAAGGAGTCACATGG - Intronic
1067080727 10:43210893-43210915 TGCTGCTCCAAGGAGTCAGAGGG - Intronic
1067080741 10:43210957-43210979 TGCTGCTCCAAGGAGTCAGAGGG - Intronic
1067203166 10:44192472-44192494 TCCTTCCCACAGGTGGCACATGG - Intergenic
1067754544 10:48995119-48995141 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1069676082 10:70248946-70248968 TTCTTCCCCAGCTAGTCACATGG + Exonic
1071750637 10:88471759-88471781 CCCCTCCCCATGGAGTCTCATGG + Intronic
1073223289 10:101894465-101894487 TCCTTCCCCAGGAAGTCTGACGG + Intronic
1073557143 10:104464512-104464534 TCCTTCCCCAAGGAGACCTCCGG + Intergenic
1073656842 10:105425632-105425654 TCCTTCCCAAAGGAGACTCCTGG - Intergenic
1073860519 10:107732794-107732816 CCCTTCCCCCAGGAGTCACTGGG + Intergenic
1074815341 10:117137911-117137933 GCCTTCCTCAAGGAGCCGCAGGG - Exonic
1075736651 10:124668569-124668591 TCCTTCCACAAGGGGACACAAGG + Intronic
1076568451 10:131414700-131414722 TCATTCCCCAGGGAGCCTCAAGG + Intergenic
1076927612 10:133500622-133500644 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1078066432 11:8081803-8081825 TCCTTCCCCAGGCGGCCACATGG - Intronic
1079032843 11:16998371-16998393 TCCCTCCCCAAGGAGCAACCTGG + Intronic
1081608851 11:44546455-44546477 TCCTTCCCCAAGGAGACCTCCGG + Intergenic
1081875302 11:46404455-46404477 TCCTTGCCCTAGGAGGGACAAGG + Intronic
1085685759 11:78620774-78620796 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
1085747382 11:79126833-79126855 TCCTTCCCCAAGGAGACATCTGG + Intronic
1086833924 11:91598978-91599000 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
1087410943 11:97789560-97789582 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1087789438 11:102391364-102391386 TCTGCCCCCAAGGAGTCACATGG - Intergenic
1088191868 11:107235912-107235934 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1089260603 11:117221463-117221485 TGCTTCCCCAGGGAGCCAAATGG + Intronic
1090221806 11:125032991-125033013 TCCTTCCCCAAGGAGACCTCCGG - Intronic
1091717695 12:2791423-2791445 ACCTTCCTCCAGGACTCACACGG + Intergenic
1093032057 12:14297367-14297389 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1093751060 12:22800512-22800534 ACCTTCCCCAAGGAGGTGCATGG + Intergenic
1094102335 12:26777842-26777864 TCCTTCCCCAAGGAGACCTTTGG + Intronic
1097178545 12:57157726-57157748 TCCTCCCTCAGGGAGTTACATGG - Intronic
1099400261 12:82194840-82194862 TCCTTTCCCAAGGAGACCCATGG + Intergenic
1099401312 12:82206116-82206138 TCCTTCCCCAAGGAGACCCGTGG - Intergenic
1099526193 12:83721712-83721734 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
1099735592 12:86563628-86563650 TCCTTCCCCAAGGAGACCTCTGG + Intronic
1101263934 12:103064698-103064720 TCCTTCCCCAAGGAGACCTTTGG + Intergenic
1103216057 12:119202277-119202299 TCCTTCCCGAGGGAGCCACCAGG - Intronic
1103558190 12:121778493-121778515 ACCTTCCCAAAGGAGGCTCAGGG + Exonic
1105207959 13:18238854-18238876 TCCTTCACCAGGGAGCCACGGGG + Intergenic
1105733739 13:23246466-23246488 ACCTTCCCCAAGGAATTTCAGGG + Intronic
1105874345 13:24540017-24540039 TCCGTCCCCAAGGTGTCATGAGG - Intergenic
1106600856 13:31185471-31185493 GCCTCCCCCAGGCAGTCACATGG + Intergenic
1108430276 13:50346492-50346514 GCCTTCCCCCAGGAGTAAAAGGG + Intronic
1109087601 13:57995842-57995864 TCCTTCTCCAAGCAGTAAGAGGG + Intergenic
1109293029 13:60498724-60498746 TCCTTCCCCAAGGAGACCTCCGG + Intronic
1109516081 13:63443893-63443915 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
1112389402 13:98969417-98969439 ACATTCCCCAAAGAGTCACCAGG + Intronic
1115869038 14:37779143-37779165 TCCTTTCCCCAGGAGTCACTGGG + Intronic
1116282760 14:42929294-42929316 TCCTTTCCTCAGGAGTCACTGGG + Intergenic
1116531637 14:45979618-45979640 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1117216630 14:53558684-53558706 TCCTTCCCCAAGGAGGCATGAGG + Intergenic
1117596469 14:57331298-57331320 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1118870575 14:69737664-69737686 TTCTTCCCCAAGCTGTCACTTGG - Intronic
1119569938 14:75661300-75661322 TCCTTCCCCAGGAAGGCTCAGGG - Exonic
1120556190 14:85931850-85931872 TCCTTCCCCAAAGAGACATCTGG - Intergenic
1121014174 14:90538399-90538421 TCCTTCCCCAAGCCCTCTCATGG - Exonic
1121618542 14:95330522-95330544 TACTTCCCCAGGGCCTCACAGGG - Intergenic
1122269858 14:100564047-100564069 TCCTACTCCAAGCAGTCACCGGG - Intronic
1124597663 15:31103985-31104007 TCCTCCCCCATGAAGTCACTTGG + Intronic
1124651582 15:31477989-31478011 TTCTTCCCCAGAGAGCCACATGG - Exonic
1127356707 15:58207771-58207793 TCCTTCCCCAAGGAGACCTCTGG + Intronic
1128236879 15:66073631-66073653 TGGTTCCCCAGGGAGACACAGGG + Intronic
1129423707 15:75450754-75450776 TCCCTCCCCACGGAGACATAGGG + Intronic
1130417835 15:83710738-83710760 TCCATCCCAAAGGAGGCAGAGGG + Intronic
1131256027 15:90863060-90863082 TCCTCCCCCAAGCAGGCACCAGG + Intergenic
1131591766 15:93757055-93757077 TCATTCCCCAAAAAGCCACATGG + Intergenic
1132879243 16:2154262-2154284 TGCCTCCCTAAGGAGGCACATGG + Intergenic
1136189406 16:28606713-28606735 GCCTGCCCCCAGGAGTCACATGG + Intronic
1136317632 16:29463687-29463709 GCCTGCCCCCAGGTGTCACATGG - Intronic
1136380596 16:29892969-29892991 TCCTGCCCCCAGAAGTCAGAAGG + Intronic
1136432207 16:30203032-30203054 GCCTGCCCCCAGGTGTCACATGG - Intronic
1136541498 16:30929995-30930017 CCCTACCCCGAGGAGTCACCAGG - Intronic
1139709462 16:68764657-68764679 TCCTTCTCCAAGAACACACAGGG - Intronic
1139906972 16:70372807-70372829 TCTTACCCCCAGGTGTCACACGG + Exonic
1144665102 17:17097012-17097034 TTCTTCCCCAGGGAGTTGCAAGG - Intronic
1149236196 17:54593662-54593684 TCCTTCCCCAAGGAGACCTAGGG - Intergenic
1150172186 17:63009950-63009972 TCCTTCCCCAAAGAGTGCCTAGG - Intronic
1151184192 17:72351294-72351316 TCCTTCTGCAAGGGGTTACAGGG - Intergenic
1155176468 18:23305684-23305706 TCCTGCCCCAAGAAGACAAATGG - Intronic
1155315252 18:24564684-24564706 TTCTTCCCAAAGCAGCCACAGGG - Intergenic
1156303671 18:35857312-35857334 CCCTTCCCCAAGGAGTCCTCTGG + Intergenic
1157370399 18:47105844-47105866 TCCAGTCCCAAGGTGTCACATGG + Intergenic
1157442212 18:47719699-47719721 GCATTCCCCATGGAGCCACAAGG - Intergenic
1159287596 18:66374057-66374079 TCCTTCCCCAAGGAGACCTCAGG + Intergenic
1159763435 18:72456451-72456473 TCCTTCCCCAGGGAGTGAAGAGG + Intergenic
1160222883 18:76990002-76990024 TCCCTGCCCCAGAAGTCACACGG - Intronic
1160274819 18:77421622-77421644 TCCTACCCCACGGAGTCTCGCGG - Intergenic
1161241603 19:3226157-3226179 TCCTTCCCCAAGGCCTCTCCAGG - Intronic
1163187315 19:15647872-15647894 TCCCTCCAGAAGGAGTCCCATGG + Intronic
1164721605 19:30436153-30436175 TCCATCCCCAAGGGGACACTTGG + Intronic
1167510126 19:49891328-49891350 GCCTTCCCCAGAGAGTCAGAAGG - Intronic
1167510328 19:49892388-49892410 GCCTTCCCCAGAGAGTCAGAAGG - Intronic
1168617436 19:57850020-57850042 TGCTTCCCCAAGTAGTCCGATGG + Exonic
1168625725 19:57916408-57916430 TGCTTCCCCAAGTAGTCCGATGG - Exonic
925460524 2:4059050-4059072 TCCTTCCCCAAGGAGACCTCCGG + Intergenic
927184440 2:20472295-20472317 TCCCTCCCCAAGGGGACACTGGG - Intergenic
930207242 2:48600185-48600207 TTCTTCCCCAGGAAGTCTCACGG - Intronic
930464625 2:51731785-51731807 TACTTCCCCAACGAGTCTGAAGG + Intergenic
930536246 2:52649302-52649324 TTCTTCACCAGGGAGTAACAGGG + Intergenic
931928351 2:67099802-67099824 TCCTTCCCCAAAGATACAGAAGG + Intergenic
932005891 2:67926569-67926591 TTTTTCCTCAAGGAGTCATATGG + Intergenic
932088582 2:68784592-68784614 TCCTACCCCAGGGAATCACCAGG + Intronic
933724140 2:85417033-85417055 CACTTTCCCAAGAAGTCACAAGG - Intronic
933936242 2:87205886-87205908 TCTTCTCCCAAGGAGTCTCAGGG - Intergenic
935564514 2:104591680-104591702 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
936356907 2:111759943-111759965 TCTTCTCCCAAGGAGTCTCAGGG + Intergenic
936512481 2:113159359-113159381 TCTTCCCCCAGGCAGTCACATGG - Intronic
938775120 2:134534862-134534884 TTCTTCCTCAAGGATTCACTTGG - Intronic
939044866 2:137238281-137238303 TCCTGTGCCCAGGAGTCACAAGG - Intronic
940472278 2:154114517-154114539 TCCTTCCCCAAGGAGACTTCTGG - Intronic
940520474 2:154739499-154739521 TCCTTCCCCAAGTGGTAATAAGG - Intronic
941088913 2:161151030-161151052 TTCTTAACCAATGAGTCACAAGG - Intronic
941423519 2:165314349-165314371 AATTTCCTCAAGGAGTCACAAGG - Intronic
942189713 2:173457605-173457627 TCCCTCCCACAGGAGTCCCACGG - Intergenic
944412428 2:199457669-199457691 TCCTTCCCGAAGGTGTGAAAAGG - Exonic
945036750 2:205710212-205710234 TCCTCCCACAAGGAGACAAAGGG + Intronic
945641970 2:212442410-212442432 TCCTTCCCCAAGGAAACTTAAGG + Intronic
946186732 2:217985141-217985163 TCTTTTCCCAAGGTGCCACAGGG + Intronic
946400554 2:219466256-219466278 TCCCTCCCCAAGTGGACACATGG + Intronic
946546419 2:220749274-220749296 TCCTCCCCCAAGGAGTTCAAAGG - Intergenic
946703983 2:222439202-222439224 TCCTTCCCCAAGGAGACCTCTGG - Intronic
948754305 2:240150246-240150268 TCCTTCCCCCAGGGGAGACAGGG - Intergenic
949067655 2:242003168-242003190 CCCTCCCCTAAGGAGTCACCAGG - Intergenic
1169029677 20:2397736-2397758 CCCTTCCTCAAAGAGTCACCTGG - Intronic
1173760132 20:45552646-45552668 TACTTCCCCATGTAGTCCCAGGG - Intronic
1174307906 20:49627603-49627625 TGCTTCCTCAAGGAGTCTCATGG + Intergenic
1175132007 20:56796370-56796392 TCCTTCCCCTGGGAGTCAGAGGG - Intergenic
1175336489 20:58199558-58199580 TCCTTCCCAAAGGAGGATCATGG + Intergenic
1175642129 20:60639664-60639686 TCCCTCCCGATGGAGTCATATGG + Intergenic
1175697837 20:61115872-61115894 TACTTCCCCATGGAGACAGAGGG - Intergenic
1175936986 20:62518463-62518485 TCATTCCCCAAGGAGCCACCAGG + Intergenic
1177002808 21:15634956-15634978 TCCTTCCCCAGGGAGACATTTGG - Intergenic
1177363543 21:20104440-20104462 TCCTTCCCCAAGGAGACTTTTGG + Intergenic
1177505809 21:22015933-22015955 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1178714776 21:34954352-34954374 TCCTGCCACAAGGAGTCAGAAGG - Intronic
1180709167 22:17828154-17828176 CCCAGCCCCAAGGGGTCACAAGG + Intronic
1180758524 22:18180739-18180761 TCCTTCGCCAGGGAGCCACGGGG + Intergenic
1180768811 22:18364531-18364553 TCCTTCGCCAGGGAGCCACGGGG + Intergenic
1180777501 22:18497864-18497886 TCCTTCGCCAGGGAGCCACGGGG - Intergenic
1180810223 22:18755174-18755196 TCCTTCGCCAGGGAGCCACGGGG - Intergenic
1180826686 22:18867755-18867777 TCCTTCTCCAGGGAGCCACGGGG + Intergenic
1181196365 22:21189426-21189448 TCCTTCTCCAGGGAGCCACGGGG - Intergenic
1181213162 22:21303698-21303720 TCCTTCTCCAGGGAGCCACGGGG + Intergenic
1181523809 22:23466685-23466707 TCCTTCCCCAGGGAGCCACGGGG + Intergenic
1181556922 22:23676463-23676485 TCCTGCACCAAGGAGACACTTGG + Intergenic
1181697447 22:24601073-24601095 TCCTGCACCAAGGAGACACTTGG - Intronic
1181915402 22:26275827-26275849 TCCTACCCTGAGGAGTCACTGGG + Intronic
1181920553 22:26317279-26317301 TCCTTCCCCCAGAAGTTACCAGG + Intronic
1182526870 22:30926024-30926046 TCCTTCCCTAAGGAGTCCTGTGG + Intronic
1183191943 22:36327232-36327254 TCCTTCCTCAAGGAGCCAGTGGG - Intronic
1183674872 22:39293584-39293606 CCCTTCCCCAGGGAGCCTCAGGG + Intergenic
1184248353 22:43246855-43246877 CCCATCCCCACGAAGTCACAGGG - Intronic
1203230433 22_KI270731v1_random:105415-105437 TCCTTCGCCAGGGAGCCACGGGG + Intergenic
1203276829 22_KI270734v1_random:93665-93687 TCCTTCGCCAGGGAGCCACGGGG + Intergenic
949170238 3:988014-988036 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
950087512 3:10270755-10270777 TCCTTCCCTAAGGAATTTCAGGG + Exonic
950658875 3:14454184-14454206 TCCTGCCCCAACAAGTCAGAGGG - Intronic
950730439 3:14952064-14952086 TCTGTCTCCAAGGAGTAACATGG + Intronic
953897586 3:46813911-46813933 TCCTTCCCCAAGGAGACCTATGG - Intergenic
954511722 3:51131391-51131413 TCCTTCCCCAAGGAGACCTCCGG - Intronic
954744395 3:52778850-52778872 TCCTTATCCAAGGGCTCACATGG + Intronic
956682115 3:71790543-71790565 TCTTTCCCCAAATAGCCACATGG + Intergenic
957124036 3:76134675-76134697 TCCTTTCGTAAGGGGTCACAAGG - Intronic
958934111 3:100239214-100239236 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
959226968 3:103598689-103598711 TCCTTCCCCAAGGAGACCTCCGG - Intergenic
962411493 3:135144857-135144879 TCCTTACCCTGGGAGTCACCTGG - Intronic
963301225 3:143599145-143599167 TCCTTTCCCCATGAGGCACACGG - Intronic
965226950 3:166002185-166002207 TCCTTCCCCAAGGAGACCTTTGG - Intergenic
965545057 3:169907669-169907691 TCATTCCCCAAGGAGGGAGAAGG + Intergenic
965821194 3:172686153-172686175 GCCTTCCCAAAGCAGTCTCAAGG - Intronic
966648374 3:182271609-182271631 TCCGTCACCAAGGAGGCAGACGG + Intergenic
967884754 3:194325826-194325848 TCCTTCCCCGAGGGGACAGAGGG + Intergenic
969092827 4:4708314-4708336 TGCTTCCAGAAGGAGACACAAGG + Intergenic
969286066 4:6202525-6202547 TCCTTCCCCAGGGCTTCATAGGG + Intergenic
969309468 4:6345152-6345174 TCCTTCCCACAGGGCTCACACGG + Intronic
969553793 4:7892433-7892455 GCATTCCCCAAGGAGACACTGGG + Intronic
970531548 4:16990327-16990349 TCCTTCCCTCTGAAGTCACAGGG + Intergenic
972404781 4:38735284-38735306 TGCTTTCCCAAGTAGCCACAGGG - Intergenic
973082169 4:46006886-46006908 CCCTCCCCCAAGGAGTAAGAGGG + Intergenic
973118248 4:46487627-46487649 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
973130381 4:46641102-46641124 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
974726886 4:65810050-65810072 TCCTTCCCCAAGGAGACCTATGG + Intergenic
974747105 4:66090339-66090361 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
975546792 4:75568516-75568538 TCCATCTCCAAACAGTCACATGG + Intergenic
975671775 4:76787422-76787444 TCCAGCCCCAAGGAAGCACAGGG - Intergenic
977669357 4:99678005-99678027 CTCTTCCCCAATGACTCACATGG + Intergenic
978561400 4:110037519-110037541 TGCTTCTCCCAGGAGGCACATGG - Intergenic
978887951 4:113788134-113788156 TCCTTCCCCAAGTAGGGACTTGG + Intergenic
979479948 4:121205244-121205266 TCTTTCCCCAATAAGCCACATGG - Intronic
979929873 4:126617223-126617245 TTCTCCCTCAAGGAGTCCCATGG + Intergenic
980601969 4:135038056-135038078 TCCTTCCCCAAGGAGACTTCTGG + Intergenic
980688497 4:136260917-136260939 TTCTTTCCCAAGGAGCCTCATGG + Intergenic
980791861 4:137631464-137631486 TCCCTTCCCCAGGAGTCACTGGG - Intergenic
981262893 4:142743423-142743445 TCCTTGGCCAAGAATTCACAGGG - Intronic
981511773 4:145565934-145565956 CCCTTTCCCCAGGAGTCACTGGG - Intergenic
981745957 4:148052659-148052681 TCCTTCCACAAGAAGGCACTAGG - Intronic
982527010 4:156490987-156491009 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
982835335 4:160115225-160115247 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
983184868 4:164690152-164690174 TCCTTCCCCAAGGAGACCTTTGG + Intergenic
985461481 4:190111642-190111664 TCCCTCCCCCAGAAGTCACTGGG + Intergenic
985786374 5:1897458-1897480 GCCTTCTCCAAGGGGTCCCATGG - Intergenic
985954308 5:3251934-3251956 TCCTTCCCAGAGGGGACACAGGG - Intergenic
986122033 5:4848375-4848397 TCCTTCCTAAAAGTGTCACATGG + Intergenic
986266961 5:6199126-6199148 TCCATCCCCTATGAGTCACACGG + Intergenic
986602816 5:9490717-9490739 GTTTGCCCCAAGGAGTCACAGGG - Intronic
987152982 5:15060248-15060270 TCCTTCCCCAAGGAGACTTCTGG + Intergenic
987504207 5:18748444-18748466 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
987926219 5:24345260-24345282 TCCTTCCCAAGAGAGACACAAGG - Intergenic
988092414 5:26561180-26561202 TCCTTCCCCAAGGAGACCTCCGG + Intergenic
989097633 5:37795915-37795937 TCCTTCCCCAAGGAGACTTCTGG + Intergenic
991330930 5:65491112-65491134 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
991915007 5:71597134-71597156 TCTTTCCCCAGAGAGTTACAAGG - Intronic
992242675 5:74788019-74788041 TCCTTCCCCAAGGAGACCTCTGG + Intronic
993780513 5:92060971-92060993 TCCTTCCCAAAGGAGACATCTGG + Intergenic
994163081 5:96579146-96579168 TCCTTCCCCACTGGGACACATGG - Intronic
994855619 5:105114983-105115005 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
995600292 5:113788800-113788822 GCCTTAACCAAGGAGGCACAAGG + Intergenic
995967708 5:117929337-117929359 TCCTTACCCAGGAAGTCAGAAGG - Intergenic
996385665 5:122907459-122907481 TCTTTCACCTAGGAGTCACGGGG + Intronic
996908882 5:128633440-128633462 TCCTTCCCCAAGGAGACTTCTGG - Intronic
997052615 5:130400218-130400240 TCCTTCCCTAAGCAGTCTGAGGG + Intergenic
998290522 5:140909949-140909971 TCCTTCCCCATGGAGACCTACGG - Intronic
999272329 5:150303689-150303711 TCTTGCCCTAAGGAGACACAGGG + Intronic
999351196 5:150873435-150873457 TCCTTCCCCAAGGAGACCTCTGG + Intronic
1000046327 5:157524624-157524646 TCCATCCAAAAGGAGTTACAGGG + Intronic
1000730603 5:164829567-164829589 TCCTTCCCCAAGGAGACCTCCGG + Intergenic
1002919266 6:1554851-1554873 TGCTTCCCAAGGGAGGCACAGGG - Intergenic
1002966615 6:1972531-1972553 TACTTAACCAAGGATTCACAGGG + Intronic
1003696099 6:8407563-8407585 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1003780631 6:9421401-9421423 TCCTTCCTCCAGGAGTAACATGG + Intergenic
1004993729 6:21167808-21167830 GCCTTACTCAAGGAGACACAAGG + Intronic
1005384835 6:25275562-25275584 TTTTTACCCAAGGAGTCACTGGG + Intergenic
1006019858 6:31111671-31111693 TCGTTCCCCAACCAGTCCCAGGG + Exonic
1006502030 6:34465540-34465562 TCCCGCCCCATGGGGTCACAGGG + Intergenic
1006628193 6:35412465-35412487 TCCTGCTCCATGCAGTCACAGGG - Intronic
1008079549 6:47179764-47179786 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1008219803 6:48842374-48842396 TTCTTCCCCATGGTTTCACAAGG + Intergenic
1009787179 6:68354913-68354935 TCCTTCCCCAAGGAGACTTCTGG - Intergenic
1010325520 6:74558013-74558035 TCCTTCCCCAAGGAGACCACTGG - Intergenic
1012820607 6:104081501-104081523 TCCTTCCCCAGGGAGACCCCTGG + Intergenic
1013460656 6:110372079-110372101 TCCTTCCCCAGATATTCACATGG + Intergenic
1013633379 6:112006541-112006563 TCCTTCTCCAAAGAAACACATGG - Intergenic
1014895503 6:126895141-126895163 GCCTTCCCCAAAGAGACCCATGG + Intergenic
1014995942 6:128144470-128144492 TCCTCCCCCAGAGAGTCACATGG + Intronic
1016120097 6:140334070-140334092 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1016759301 6:147719517-147719539 TACTTCCTCAAGAGGTCACAAGG - Intronic
1018036428 6:159886561-159886583 TTTTGCCCCCAGGAGTCACAAGG - Intergenic
1018535207 6:164811892-164811914 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1018569760 6:165196653-165196675 TCCTTCCCCAAGGAGACCTCCGG + Intergenic
1018599685 6:165526104-165526126 TCCTTCCCCAAGGAGACCTCCGG + Intronic
1019666922 7:2256650-2256672 TCCGCCCCCCAGGAATCACAGGG + Intronic
1020826601 7:13036584-13036606 TCCTCTCTCATGGAGTCACAAGG + Intergenic
1022438598 7:30413561-30413583 TCTTTCCCCAAGGACACAGATGG - Intergenic
1023556493 7:41428837-41428859 TCCATCCCCAAGGATTTTCATGG + Intergenic
1024958451 7:54950504-54950526 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1028141554 7:87280558-87280580 TCCTTCCCCAAGGAGACTTTTGG + Intergenic
1028168367 7:87565850-87565872 CCCTTCCCCAAATAATCACATGG + Intronic
1030270698 7:107665470-107665492 CCTGTCCCCCAGGAGTCACAGGG - Intronic
1030368555 7:108672611-108672633 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
1031107392 7:117561854-117561876 TCCTTACACAAAGAGGCACAAGG + Intronic
1032316500 7:130843234-130843256 TCCTTCCCAAAGGGATTACAGGG - Intergenic
1032408289 7:131673745-131673767 TGCTACCCCAAGGAGTTACTGGG - Intergenic
1032630319 7:133643944-133643966 TCCTTCCCCAAGGAGACCTCTGG - Intronic
1033544094 7:142384407-142384429 ACCTGCCCCCAGGAGGCACAGGG - Intergenic
1033560897 7:142529318-142529340 ACCTGCCCCCAGGAGACACAGGG - Intergenic
1035350692 7:158244145-158244167 TCCTTCCCCCAGGACTTCCATGG + Intronic
1036738258 8:11338855-11338877 TCCTTCTCCAAAGAGACACGTGG + Intergenic
1037154597 8:15684557-15684579 TTCTTCCCCAGGGAGTCCCAAGG - Intronic
1038608776 8:29039175-29039197 AGCTTCCCCAAGTAGTCACCAGG - Intronic
1038859967 8:31376091-31376113 TCCCTTCCCCAGGAGTCACTGGG + Intergenic
1039899373 8:41740507-41740529 CCCCTCCCCTAGGAGTCCCAAGG + Intronic
1040889611 8:52303205-52303227 TCCTTCCCCAAGCCTTCAGAGGG - Intronic
1041440537 8:57891556-57891578 TCCTTCCCAAATGCATCACAAGG + Intergenic
1042849594 8:73203308-73203330 ACCCTGCCCAAGGAATCACAGGG - Intergenic
1043610216 8:82053819-82053841 CTCTTCACCAAGGAGTCACAAGG - Intergenic
1044085535 8:87937883-87937905 TCCTTCCCCATGAATCCACATGG - Intergenic
1045221573 8:100205264-100205286 TCCTTCCCCAAGGAGACCTCTGG + Intronic
1046197375 8:110882823-110882845 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
1046287299 8:112110670-112110692 TCCTACACCAATGAGACACAAGG - Intergenic
1046417843 8:113939233-113939255 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1046993654 8:120489853-120489875 GCGTTGCCCAATGAGTCACATGG - Intronic
1048172674 8:132122739-132122761 TCCTACCACAGGGATTCACAAGG + Exonic
1048272888 8:133043624-133043646 ACCTTGCCCAAGGCCTCACAAGG + Intronic
1049246868 8:141567477-141567499 TCCCTCTCCAAGGAGTCCCCGGG - Intergenic
1049305740 8:141902853-141902875 GCCTTCCCCAAGGCCTGACACGG + Intergenic
1049878630 8:145045675-145045697 TCTTTCCCTAAGCAGTCCCATGG + Intergenic
1050482476 9:6101199-6101221 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
1054796723 9:69309084-69309106 TCCTTCCTGAAGAAGGCACAGGG - Intergenic
1056718404 9:89053101-89053123 TCCCTCCTGAAGGAGCCACAGGG + Intronic
1057047849 9:91899618-91899640 TCCGTCCCCAAGGAGAAAGATGG + Intronic
1057074773 9:92132707-92132729 TCCTGCCCCCAGCACTCACAGGG - Intergenic
1058019692 9:100074654-100074676 TCCTTCCCCAAGGAGACCTCTGG + Intronic
1060377469 9:123129685-123129707 TCCTACCCCAGGCAGTCACTGGG + Intronic
1061476803 9:130873057-130873079 GCCTGCGCCATGGAGTCACAGGG + Intronic
1061779513 9:132987441-132987463 TCATTCCCCAGGGAGTGCCAAGG + Intronic
1062231989 9:135486935-135486957 CCATTCCCCAGGGAGTCCCAGGG + Exonic
1185835390 X:3341961-3341983 ACCTTCCCCCAGGATTCAAATGG + Intronic
1186643866 X:11485696-11485718 TCCTGCCCCAAGTCATCACAGGG - Intronic
1189276256 X:39788126-39788148 ACCTTCCCCATGGTGTCTCAGGG + Intergenic
1189757467 X:44285533-44285555 ACCTTCCCCAAGGAGTTTCAGGG + Intronic
1189973530 X:46440704-46440726 ACCTTCCCCATGGTGTCTCATGG + Intergenic
1191719434 X:64217076-64217098 TCCTTCCCCAAGGAGACTTCTGG - Intergenic
1191759168 X:64628500-64628522 TCCTTCCCCAAGGATACACCTGG + Intergenic
1191769693 X:64741518-64741540 TCCTTCCCCAAGGAGACCCCTGG - Intergenic
1191941441 X:66485280-66485302 TCCTTCCCCAAGGAGACCTCAGG - Intergenic
1192297903 X:69869424-69869446 TCCTTCCCCAAGGAGACCTCCGG - Intronic
1192717921 X:73663443-73663465 TCGTTCCCCAAAGATTAACAGGG + Intronic
1193599442 X:83491550-83491572 TCTTTCCCTAAGGAATTACATGG + Intergenic
1194179781 X:90697370-90697392 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1194833754 X:98657374-98657396 TCCTTCCCCAAGGAGACCTCAGG + Intergenic
1195749041 X:108146068-108146090 TCCTTCCCCAAGGAGACCTCCGG - Intronic
1196505804 X:116440354-116440376 TTATTCTCCAAAGAGTCACAAGG - Intronic
1197002094 X:121451532-121451554 TCCTTCCCCAAGGAGACCTCTGG + Intergenic
1197245302 X:124160730-124160752 TCCTTCCCCAAGGAGACCTCTGG - Intronic
1198434033 X:136597825-136597847 TCATTCATCAAGGAGTCACTAGG - Intergenic
1198701097 X:139398869-139398891 TCCTTCCCCAAGGAGACTACTGG + Intergenic
1198783231 X:140259222-140259244 TCCTTCCCCAAGGAGACCTCCGG - Intergenic
1199515884 X:148675050-148675072 CCCCTCCCCAAAGAGACACATGG - Intronic
1200279076 X:154761722-154761744 TACTTCCCCAGTGATTCACACGG + Intergenic
1200526439 Y:4279539-4279561 TCCTTCCCCAAGGAGACCTCTGG - Intergenic
1202100237 Y:21299960-21299982 TCCTTCCCCAAGGAGACCTCTGG + Intergenic