ID: 1066442029

View in Genome Browser
Species Human (GRCh38)
Location 10:35448643-35448665
Sequence CTGGGAAGGCTCCTTCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 316}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066442029_1066442038 8 Left 1066442029 10:35448643-35448665 CCTTGGGGAAGGAGCCTTCCCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 1066442038 10:35448674-35448696 GCATGCGCCTGGTGGGTTTGAGG No data
1066442029_1066442044 24 Left 1066442029 10:35448643-35448665 CCTTGGGGAAGGAGCCTTCCCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 1066442044 10:35448690-35448712 TTTGAGGGGCAGAGGGAGTGTGG No data
1066442029_1066442046 26 Left 1066442029 10:35448643-35448665 CCTTGGGGAAGGAGCCTTCCCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 1066442046 10:35448692-35448714 TGAGGGGCAGAGGGAGTGTGGGG No data
1066442029_1066442045 25 Left 1066442029 10:35448643-35448665 CCTTGGGGAAGGAGCCTTCCCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 1066442045 10:35448691-35448713 TTGAGGGGCAGAGGGAGTGTGGG No data
1066442029_1066442035 -3 Left 1066442029 10:35448643-35448665 CCTTGGGGAAGGAGCCTTCCCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 1066442035 10:35448663-35448685 CAGCAGAGTGGGCATGCGCCTGG No data
1066442029_1066442042 16 Left 1066442029 10:35448643-35448665 CCTTGGGGAAGGAGCCTTCCCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 1066442042 10:35448682-35448704 CTGGTGGGTTTGAGGGGCAGAGG No data
1066442029_1066442040 10 Left 1066442029 10:35448643-35448665 CCTTGGGGAAGGAGCCTTCCCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 1066442040 10:35448676-35448698 ATGCGCCTGGTGGGTTTGAGGGG No data
1066442029_1066442036 0 Left 1066442029 10:35448643-35448665 CCTTGGGGAAGGAGCCTTCCCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 1066442036 10:35448666-35448688 CAGAGTGGGCATGCGCCTGGTGG No data
1066442029_1066442047 27 Left 1066442029 10:35448643-35448665 CCTTGGGGAAGGAGCCTTCCCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 1066442047 10:35448693-35448715 GAGGGGCAGAGGGAGTGTGGGGG No data
1066442029_1066442039 9 Left 1066442029 10:35448643-35448665 CCTTGGGGAAGGAGCCTTCCCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 1066442039 10:35448675-35448697 CATGCGCCTGGTGGGTTTGAGGG No data
1066442029_1066442037 1 Left 1066442029 10:35448643-35448665 CCTTGGGGAAGGAGCCTTCCCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 1066442037 10:35448667-35448689 AGAGTGGGCATGCGCCTGGTGGG No data
1066442029_1066442043 17 Left 1066442029 10:35448643-35448665 CCTTGGGGAAGGAGCCTTCCCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 1066442043 10:35448683-35448705 TGGTGGGTTTGAGGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066442029 Original CRISPR CTGGGAAGGCTCCTTCCCCA AGG (reversed) Intronic
900554556 1:3273233-3273255 ATGGGGAGGCTGCCTCCCCAGGG + Intronic
900798264 1:4722639-4722661 CTGAGAAGGGTCCTCACCCAGGG - Intronic
901909918 1:12448393-12448415 GTGGGAAGGCATATTCCCCATGG + Intronic
902558285 1:17260076-17260098 CTGGGACAACTCCTTCTCCAGGG - Intronic
902583935 1:17426492-17426514 CTGAGAAATCTCCTTCCCCCAGG + Intronic
902675402 1:18005226-18005248 CTTGGACAGCACCTTCCCCAGGG - Intergenic
903953520 1:27010223-27010245 CTGGGAAGGCTCCTTACAGTAGG + Intronic
904946117 1:34199919-34199941 CTGAGAAGGTTCCTTCCAGAAGG - Intronic
905183387 1:36179678-36179700 CTGTGGAGGCTCGGTCCCCAGGG + Exonic
906074658 1:43043120-43043142 CAGTGAAGACTCCATCCCCAAGG + Intergenic
906299926 1:44674388-44674410 CTGGGCCGGCGCCTTCACCATGG - Exonic
906960072 1:50414941-50414963 CGGGGAAGGCCACTTCCGCAAGG - Intergenic
908134500 1:61116174-61116196 CTGAGAACTCTCCTTCTCCAAGG - Intronic
908136716 1:61140664-61140686 ATGGGAAAGCTCCTTCCAAAAGG + Intronic
911046893 1:93636148-93636170 CTGAAAATTCTCCTTCCCCAAGG - Intronic
911831305 1:102554072-102554094 TGAGGAATGCTCCTTCCCCAGGG - Intergenic
912297185 1:108481449-108481471 CTGGAAGGGTTCCTGCCCCATGG + Intergenic
912563157 1:110564680-110564702 GTGTGAGAGCTCCTTCCCCATGG + Intergenic
913164096 1:116169243-116169265 CTGGGAATGCTGGGTCCCCAAGG - Intergenic
915088473 1:153405058-153405080 CCAGGAAGGCTCCTTGGCCAAGG - Intergenic
917521311 1:175750444-175750466 CTGGAAAGGCACCGTACCCAGGG + Intergenic
918240415 1:182615551-182615573 CTGGGAGCGATCCTTTCCCAAGG - Intergenic
919919368 1:202159248-202159270 CTCGGAAGACCCCTCCCCCAGGG + Intronic
920061929 1:203232910-203232932 CTGGGGAGGAGCCTTCCCCAGGG + Intronic
922581623 1:226702691-226702713 ATGGGAAGGCACCCTCCCAATGG - Intronic
922704008 1:227779399-227779421 GTGGGGAGGCTGCTCCCCCAGGG + Intronic
923680371 1:236113799-236113821 CCGGGAAGGAGCCTCCCCCAGGG - Intergenic
1064562076 10:16603534-16603556 CTGTGAAAGCTCCTTCCCCAGGG - Intronic
1065250202 10:23803300-23803322 CTGGGAATGCCCCTTCCTGATGG + Intronic
1066442029 10:35448643-35448665 CTGGGAAGGCTCCTTCCCCAAGG - Intronic
1067178905 10:43970390-43970412 CCAGGATGGCTCCTTCCCCTTGG + Intergenic
1068496111 10:57787026-57787048 CTGGGAAGGCTCATTCCCGAGGG - Intergenic
1068984484 10:63094539-63094561 CCTGGAATGCTCTTTCCCCATGG - Intergenic
1070928910 10:80246656-80246678 CTGGGAAGGCCCTGCCCCCATGG - Intergenic
1072789832 10:98309921-98309943 CTGGGAGAGCTCCTTTGCCAAGG + Intergenic
1072825800 10:98604999-98605021 CTGAGAAGGCTCCTTACCCCAGG - Intronic
1073363372 10:102917974-102917996 CAGGGACGGCTCCTTCCCATTGG + Intergenic
1074390151 10:113050350-113050372 ATGGGATGGCTCAGTCCCCAAGG - Intronic
1074870998 10:117575971-117575993 ATGGGAAGGCTCATTCACCCAGG - Intergenic
1075510324 10:123067086-123067108 CTGTGAGGGCTCTTTCCCCCAGG - Intergenic
1075890313 10:125943869-125943891 CTGGGAAGGCAGCTTTCCCAGGG + Intronic
1076298453 10:129405543-129405565 TTGGGAAGGGGCCTTCCCGAGGG + Intergenic
1076427922 10:130380640-130380662 CTGGGAAGGCTCCTCCCAGAGGG + Intergenic
1076841377 10:133047548-133047570 CTGGGCAGGCTCTATCCCGAAGG - Intergenic
1076881879 10:133243614-133243636 CTATGCCGGCTCCTTCCCCACGG + Intergenic
1077470751 11:2759434-2759456 CAGGGGATGTTCCTTCCCCAAGG + Intronic
1077500384 11:2907352-2907374 GTGGGAAGGATCCTCCCCCGTGG - Intronic
1077538766 11:3136680-3136702 CTCTGCAGGCGCCTTCCCCAGGG - Intronic
1077549837 11:3195269-3195291 CTGGGAAGGGTCCAGGCCCACGG + Intergenic
1079682939 11:23321318-23321340 CTTGGAAGGTTCCATGCCCACGG + Intergenic
1081580064 11:44345986-44346008 CTGGGAAGGCACCCTGCCCGGGG + Intergenic
1081613979 11:44579623-44579645 CTGTCAGGGCTCCCTCCCCAGGG - Intronic
1081866164 11:46361812-46361834 CAGGGCAGGCTCCTTGCCTAGGG - Intronic
1083800474 11:65043780-65043802 CTGGGAAGGCCCCTTCCTTCAGG - Intronic
1084046917 11:66574361-66574383 CTGGGAAGGCAGCTTTCCCTTGG + Intergenic
1084541715 11:69791094-69791116 CTGGGATGTCAGCTTCCCCACGG - Intergenic
1084661472 11:70548965-70548987 TAGGCAAGGCTCCTCCCCCAGGG + Intronic
1084890696 11:72235562-72235584 CTGGGAATAGTCCTGCCCCAAGG + Intronic
1086916495 11:92535308-92535330 CAGGGAAGGATGCTTCCCTAGGG + Intronic
1087584653 11:100103474-100103496 CTTGGAATGCTCTTTCCCCCTGG - Intronic
1088373628 11:109117772-109117794 CTGGGAAAGCTCCTCACCCAGGG + Intergenic
1088744216 11:112791988-112792010 CTAGGATGGCTTCTCCCCCATGG - Intergenic
1089270998 11:117301137-117301159 CTTGGCAGGCTCCTTTCTCAAGG + Intronic
1089286326 11:117410144-117410166 CTGCAATGTCTCCTTCCCCAGGG - Intronic
1089331831 11:117694723-117694745 CCAGGATGGCTCCTTCCCCTGGG - Intronic
1089366549 11:117924386-117924408 CTGGGAAGGGTCCTTTCTCATGG - Intronic
1091044377 11:132312695-132312717 ATGGGAAAGCTTCCTCCCCATGG + Intronic
1102419199 12:112790740-112790762 CGGGGAAGGCTCTTTGGCCAAGG + Intronic
1103972684 12:124681930-124681952 CAGGGAAGAATCCTGCCCCAGGG - Intergenic
1104066069 12:125306956-125306978 CTGGGCATGCTCCTGCCACAGGG + Intronic
1104389270 12:128377858-128377880 CAGTGTGGGCTCCTTCCCCAGGG + Intronic
1104745425 12:131207500-131207522 CCTGGAAGGCTCCACCCCCACGG - Intergenic
1104788915 12:131469606-131469628 CCTGGAAGGCTCCACCCCCACGG + Intergenic
1104965494 12:132507153-132507175 CTGGGGAGGATCCGCCCCCACGG - Intronic
1104971482 12:132532795-132532817 CGGGGTGGGCTCCTTCCTCAGGG - Intronic
1105693430 13:22864564-22864586 CTGGGAAGGCTGTTTCCCAGGGG - Intergenic
1106286775 13:28324769-28324791 CTGGACAGCCTTCTTCCCCACGG + Intronic
1107294583 13:38895757-38895779 CTGGGAAGGGTCCTCTCCAAAGG + Intergenic
1107833023 13:44391185-44391207 CTGGGGAGGGTCAGTCCCCAGGG + Intronic
1110304310 13:73967308-73967330 CTTGGCAGGCTCCTTCACCTTGG - Intronic
1111506846 13:89201780-89201802 CTGAGCAGTCTTCTTCCCCAAGG + Intergenic
1113698427 13:112365112-112365134 CTAGGGAGGGTCCTGCCCCATGG + Intergenic
1114613608 14:24057081-24057103 CTGGGAGGCCTTCTGCCCCATGG + Intronic
1116713033 14:48393579-48393601 CCTGGCAGGCTCCTTCTCCAGGG + Intergenic
1118846856 14:69554043-69554065 CTGGAAAGAAGCCTTCCCCAAGG + Intergenic
1118925747 14:70188649-70188671 CCGGGAGGGGTCCTTCCGCACGG + Exonic
1119028049 14:71169394-71169416 CTCTCAAGGCTCCTTCCCCTGGG - Intergenic
1119084004 14:71723141-71723163 CAGTGAGTGCTCCTTCCCCATGG - Intronic
1119425893 14:74534534-74534556 CTGGGAAGGCGCCCCCACCATGG + Intronic
1119455710 14:74753834-74753856 CAATGAAGGCCCCTTCCCCAGGG + Intergenic
1119989423 14:79178934-79178956 ATTGGAAGGGTCCTTCACCAAGG - Intronic
1121635922 14:95453826-95453848 CTGGGAAGGACGCTGCCCCATGG + Intronic
1122653977 14:103244690-103244712 CTGGGAAGGCTCATTCCCATGGG + Intergenic
1122735748 14:103839796-103839818 CTGGGCATGCTCCTACCACATGG + Intronic
1122910684 14:104826467-104826489 CTGGGGAGGCGCCTTTCCCGCGG + Intergenic
1124377231 15:29135949-29135971 CTGGGACAGCTCCTGACCCAAGG - Intronic
1125676489 15:41504933-41504955 GTGGGAAGGCTCTTGCTCCAAGG - Intronic
1128663944 15:69524643-69524665 CAGGGAGGGCTCCTTACCCCTGG - Intergenic
1128784548 15:70385241-70385263 CTGGAAAGGATCCTTGCCCCTGG - Intergenic
1128977936 15:72167025-72167047 ATGGCACGGCTCCTTCCCAATGG - Exonic
1129999773 15:80036407-80036429 CCTGGAAGGCTCTTTCCCTAAGG + Intergenic
1130520603 15:84658238-84658260 CAGGGCAGGCTCCGCCCCCAGGG - Exonic
1132317199 15:100898738-100898760 CTGGGCAGGTTGCTTTCCCAGGG - Intronic
1132471773 16:108109-108131 CTGGGGAGGCTCAGTCCCCAGGG + Intronic
1132525499 16:412154-412176 CTGGGATGTCCCCTGCCCCATGG + Exonic
1132539563 16:502271-502293 CTGGAGAAGCTCCTGCCCCAAGG + Intronic
1132633562 16:931543-931565 CTGGGGAGGCTCCTTTCCTGTGG - Intronic
1134331688 16:13257173-13257195 CTGGGATGGTTCCTTACCAATGG - Intergenic
1135970381 16:27067712-27067734 CTGGGCAGGCTGCTCCCCCGTGG - Intergenic
1137831519 16:51548151-51548173 CTGGGAATACTTCTTGCCCATGG + Intergenic
1137919352 16:52471536-52471558 CAGTTAAGGCCCCTTCCCCATGG - Intronic
1139683397 16:68582800-68582822 CTGGGAAGGCTGCTTCTCCCTGG + Intergenic
1139947970 16:70654562-70654584 CTCCAAAGGCTCATTCCCCAAGG - Exonic
1140203451 16:72913485-72913507 ATGGGAAGGGTCCTTCCCCTTGG - Intronic
1140738328 16:77918789-77918811 AAGGGAAGGCTCCTTCCTCCAGG - Intronic
1141122014 16:81366788-81366810 CTGGGAGGGCTGATTGCCCAAGG + Intronic
1141729575 16:85812654-85812676 CTGCGATGGTTCCTTCTCCACGG - Intergenic
1142803281 17:2358235-2358257 CGGTGAAGGACCCTTCCCCAGGG - Intronic
1143275484 17:5706654-5706676 CTTGTGAGTCTCCTTCCCCACGG - Intergenic
1143491898 17:7289756-7289778 CAGGGAATACTCCCTCCCCAGGG + Intronic
1143553001 17:7642779-7642801 ATGGAAAGGCTCCTTCTGCAAGG - Intergenic
1144811583 17:18003540-18003562 CAGGGAGGGCACCTTTCCCATGG + Intronic
1145089966 17:19978072-19978094 CTGGGAGGGCTCCCGCCCCAGGG - Intronic
1145286219 17:21507611-21507633 CAGGGAGGGCGCCTTTCCCATGG + Intergenic
1145391389 17:22458705-22458727 CAGGGAGGGCACCTTTCCCATGG - Intergenic
1146058052 17:29590781-29590803 GTGGGCAGGCTCCTTCCCTAGGG + Intronic
1146307587 17:31742487-31742509 CTGAGAAGGCACCATCCCGAGGG - Intergenic
1146909702 17:36641011-36641033 GTGCAAAGGCTCCTTCCCCTGGG + Intergenic
1147244854 17:39113224-39113246 CAAGGAAGGCTCCTTTCCCAGGG + Intronic
1147945569 17:44078379-44078401 CAGGGCAGGCTCCTGCTCCATGG + Exonic
1148186871 17:45650713-45650735 CTGGGCAGGCTCCGTCTTCAGGG - Intergenic
1148812858 17:50305377-50305399 CTGGGCAGTCTCCCTCCCCAAGG - Intergenic
1149595439 17:57862185-57862207 CTGGGCAGCCTCCCTCCCCGTGG + Exonic
1150917160 17:69448673-69448695 ATGAGAAGGCTCCTTCTCCCTGG + Intronic
1151290613 17:73147236-73147258 CTGAGAAGCCTGCTTTCCCAAGG + Intergenic
1151577508 17:74960119-74960141 CTGGGCAGCCTCCTCCACCAGGG + Exonic
1151926427 17:77200886-77200908 CTGGGACTGCTCTTTCCTCATGG + Intronic
1152037149 17:77880484-77880506 CAGCGAAGGATCCTTCCCCGAGG + Intergenic
1152235271 17:79135311-79135333 GTGGCCTGGCTCCTTCCCCAGGG - Intronic
1153234174 18:2970068-2970090 CTGGGAAGACTGCTTGCCTAAGG + Intronic
1154311547 18:13270692-13270714 CTGCGAGGGATCCTTCCTCAGGG + Intronic
1155112958 18:22734555-22734577 CAGGCAAGGCCCCTTCCCCTTGG + Intergenic
1155189478 18:23416580-23416602 CTGGTAACGCTCCTTTGCCAAGG + Intronic
1156341039 18:36210979-36211001 CTGGGGACTCTCATTCCCCAGGG + Intronic
1156895354 18:42239917-42239939 CTGGTAAGGCTCATGCCTCATGG - Intergenic
1157487835 18:48101070-48101092 GTGGGCTGGCTCCTTCCCCAGGG - Intronic
1157769552 18:50333770-50333792 CTGCAAAGGCTCTTCCCCCATGG - Intergenic
1158339169 18:56446938-56446960 CTGACAAGGCTACTTCTCCAGGG - Intergenic
1158792777 18:60802151-60802173 CTCTGAAGTCTCCTTCTCCATGG - Intergenic
1158828450 18:61251301-61251323 AAGGGAAGCCTCCTTCCTCAGGG - Intergenic
1158896505 18:61918986-61919008 CTGGGGAGCCTCTGTCCCCATGG + Intergenic
1159053757 18:63445294-63445316 CTGGGCAGGCTCTCTGCCCAGGG - Intergenic
1159607266 18:70487846-70487868 CTGAGAAGGCTCCACTCCCAAGG + Intergenic
1159763432 18:72456441-72456463 GTGGGAACCCTCCTTCCCCAGGG + Intergenic
1160542774 18:79634269-79634291 CTGTGCAGGCTCCTTCCAAAGGG - Intergenic
1160586555 18:79916465-79916487 CTGTGCAGGCTCCTTCCTCCAGG - Intronic
1161390812 19:4019351-4019373 CTGGGAGGGCTCCTCCCTCTGGG - Intronic
1161592371 19:5134619-5134641 CTGGGGAGGCTGCATGCCCAGGG - Intronic
1162158943 19:8697814-8697836 CTGGAACAGCTCCTTGCCCAGGG + Exonic
1162324242 19:9989365-9989387 CTGAGAATGTTTCTTCCCCAGGG - Exonic
1162530998 19:11236517-11236539 ATGGGAAGGCTCCCTCCTCCAGG + Exonic
1163400164 19:17087281-17087303 CTGGGAAGGGACTTTCTCCAGGG + Intronic
1163671974 19:18634769-18634791 CTAGGCACGCTCCTGCCCCAGGG + Intergenic
1163714283 19:18865087-18865109 TTGGGCAGGCACCTTCCCCGAGG - Intronic
1163761607 19:19140012-19140034 CTGGGAAGGCTCTTTCTCTCTGG + Intergenic
1164594287 19:29523760-29523782 CTGGGCATGCTTCTACCCCAGGG - Intergenic
1165749920 19:38253397-38253419 CTGGGGCGGCCCCTTCCCCCAGG + Intronic
1166499231 19:43328608-43328630 CTGGGAAGGCAGCTTTCCCTTGG - Intergenic
1168482663 19:56734791-56734813 CTTGGAAAGCTCCATCCCCGCGG - Intergenic
925745700 2:7041837-7041859 TTGGAAAGGCTGCATCCCCAGGG + Exonic
926612149 2:14957579-14957601 GTGGGTAGGAACCTTCCCCAAGG - Intergenic
926982836 2:18590053-18590075 CTGTCAAAGCCCCTTCCCCATGG + Intergenic
927674055 2:25091517-25091539 CTGGGAAGGCTCAGTGCCCAGGG - Intronic
928601530 2:32908586-32908608 CTGGGAAGTCATCTTCACCATGG - Intergenic
930058947 2:47272739-47272761 CTCGGAAGTCTCCTCCCCAAGGG + Intergenic
932679776 2:73815083-73815105 CAGGGAAGTATCCATCCCCAGGG - Exonic
933692408 2:85189667-85189689 CTGGGAGGGCTCCAGCCCCGGGG - Intronic
933979317 2:87537753-87537775 CTGGGAAGGGTCCGTCCTCCTGG - Intergenic
934473397 2:94576490-94576512 CAGGGATGACTCCTTCCCTATGG + Intergenic
934544139 2:95200684-95200706 CTGGGGATATTCCTTCCCCATGG + Intergenic
934739207 2:96707042-96707064 CTGGGAAGCCACCCACCCCAGGG - Exonic
935334653 2:102005382-102005404 CTGGCAGGGCTCCTTCCCCTGGG + Intronic
936163844 2:110103594-110103616 CTGGCAAGGCTCCTTATCTAGGG + Intronic
936314509 2:111413038-111413060 CTGGGAAGGGTCCGTCCTCCTGG + Intergenic
937313342 2:120915555-120915577 ATGGAAAACCTCCTTCCCCAGGG - Intronic
938375117 2:130799771-130799793 GTGTGAAGGCTGCTTCCCCTGGG - Intergenic
939598264 2:144155037-144155059 CTGGGAAGCATCCATGCCCATGG + Intronic
940663521 2:156576972-156576994 CTGTGAAGTCTCCATCTCCAAGG - Intronic
945563240 2:211364294-211364316 CTGGGAAGGCTTCTACTCCCAGG - Intergenic
947147201 2:227079042-227079064 CTTGAAAGCCTCATTCCCCATGG - Intronic
947592085 2:231391645-231391667 CTGGGAACTCCCCTTGCCCAAGG - Intergenic
947912955 2:233813519-233813541 CTGGCAAGCATCCCTCCCCAGGG - Intronic
948264786 2:236628590-236628612 CAGAAAAGGCTCCTTTCCCATGG - Intergenic
1169296916 20:4407998-4408020 CTGGGGAGGCTCCATCACCTGGG + Intergenic
1169723400 20:8703132-8703154 CTGGGAAGGAAGCTTCTCCAAGG - Intronic
1171085259 20:22232667-22232689 CAGGAAACGCTGCTTCCCCAGGG - Intergenic
1171138867 20:22723432-22723454 AAGGAAAGGCTGCTTCCCCATGG - Intergenic
1172914613 20:38434458-38434480 CACAGAAGGGTCCTTCCCCAAGG + Intergenic
1174367563 20:50065645-50065667 CTGGGAAGGCTGCTGGCCCCTGG - Intergenic
1175697839 20:61115882-61115904 CAGGGAGGGATACTTCCCCATGG - Intergenic
1175807805 20:61840237-61840259 CCGGGAAGGCCCCTGCACCAGGG - Intronic
1176093188 20:63328026-63328048 CTGGGAAGGCACCTGCCACACGG + Intronic
1176112729 20:63417910-63417932 CAGGGCAGGCTCCTTCCCGCCGG - Intronic
1176115925 20:63431927-63431949 CAGGGAAGGCTCCACCCTCAGGG + Intronic
1176115953 20:63431999-63432021 CAGGGAAGGCCCCATCCACAGGG + Intronic
1176115960 20:63432017-63432039 CAGGGAAGGCTCCACCCTCAGGG + Intronic
1176116027 20:63432197-63432219 CTGGGAAGGATCCACCCACAGGG + Intronic
1176116033 20:63432215-63432237 CAGGGAAGGCTCCACCCACAGGG + Intronic
1176116069 20:63432323-63432345 CTGGGAAGGCTCCACCCTCAGGG + Intronic
1176116087 20:63432377-63432399 CTGGGAAGGCCCCACCCACAGGG + Intronic
1176116117 20:63432449-63432471 CAGGGAAGGCTCCACCCACAGGG + Intronic
1176116129 20:63432485-63432507 CTGGGAAGGCTCCACCCTCAGGG + Intronic
1176116147 20:63432539-63432561 CTGGGAAGGCCCCACCCTCAGGG + Intronic
1176116155 20:63432557-63432579 CAGGGAAGGCTCCACCCTCAGGG + Intronic
1176116167 20:63432593-63432615 CAGGGAAGGCTCCACCCACAGGG + Intronic
1176116179 20:63432629-63432651 CTGGGAAGGCCCCACCCTCAGGG + Intronic
1176116207 20:63432701-63432723 CTGGGAAGGCCCCACCCTCAGGG + Intronic
1176116215 20:63432719-63432741 CAGGGAAGGCTCCACCCTCAGGG + Intronic
1176116221 20:63432737-63432759 CAGGGAAGGCTCCACCCACAGGG + Intronic
1176116227 20:63432755-63432777 CAGGGAAGGCTCCACCCTCAGGG + Intronic
1176116255 20:63432827-63432849 CTGGGAAGGCCCCACCCCCAGGG + Intronic
1176116271 20:63432863-63432885 CAGGGAAGGCTCCACCCACAGGG + Intronic
1176178524 20:63739494-63739516 CGGGGAGGGCCCGTTCCCCACGG - Intronic
1178090256 21:29155465-29155487 CTTGGCTGGGTCCTTCCCCATGG + Intronic
1178878576 21:36431027-36431049 CTGAGTTGGCTCCTTCCACAAGG - Intergenic
1180067560 21:45420267-45420289 CTGGGCAGGCACCTGTCCCACGG + Intronic
1181610460 22:24008057-24008079 GAGGGCAGGCACCTTCCCCAGGG + Intergenic
1182281579 22:29220512-29220534 CTGGGAAGGCTGCCTCCCTATGG + Intronic
1183206483 22:36423000-36423022 CTGTGCAGGGGCCTTCCCCAGGG + Intergenic
1183869358 22:40729486-40729508 CAGGGAAGGCTCCTCCCCTAAGG - Intergenic
1184091877 22:42297181-42297203 ATGGGCAGCCTCCTTGCCCAAGG - Intronic
1185038798 22:48493824-48493846 CTGGGAAGTCCCTTCCCCCAGGG - Intronic
1185144027 22:49119714-49119736 CAGGACAGGCTCCTTCCCCTGGG - Intergenic
1185275514 22:49948851-49948873 CAGGGACGGCCCCTCCCCCAGGG - Intergenic
1185374482 22:50475665-50475687 CTGGGAAAGCTGCATCCCCCAGG + Intergenic
950399701 3:12760446-12760468 CTGGGTGGGCTCCCTCCTCAGGG + Intronic
950964622 3:17137712-17137734 CAGGGCAGCCTCCTGCCCCATGG + Intergenic
952142369 3:30494230-30494252 CCTGGAAGTCTCTTTCCCCAGGG + Intergenic
954435511 3:50493829-50493851 TCAGGAAGGCTCCTGCCCCAGGG + Intronic
955906525 3:63813649-63813671 CTGGGAAGACTCCTTACCAAGGG - Intergenic
958637818 3:96766964-96766986 CTGGGAAGGCTCACGCCCAAGGG - Intergenic
959989576 3:112616116-112616138 CTGGGTATGCTCCTCCCCCATGG + Intronic
961158297 3:124699976-124699998 CTGGGAAGGCTGATTCCCCAGGG - Intronic
961567729 3:127775769-127775791 CTGGAAAGGGCCCTTCCCCAGGG - Intronic
961618538 3:128204714-128204736 CTGGGATGCCGCCTTCCCCAGGG + Intronic
961649301 3:128409562-128409584 CTGGGAACCCCACTTCCCCATGG - Intergenic
963151798 3:142052711-142052733 CTGGGTAGTCTCCCTCCCAAGGG + Intronic
967045784 3:185735659-185735681 AGGGGAAGGCTCCTTACCCCAGG + Intronic
967065726 3:185913580-185913602 TTGGGAAGGCTTCTTACCAACGG - Intergenic
968452183 4:680938-680960 TTGGGAAGGGACCTGCCCCAGGG + Intronic
968727371 4:2254003-2254025 CAGGGAGGGGTCCTTTCCCAAGG + Intronic
969273143 4:6116470-6116492 CAGAGAAGGCTCCTTCCTGAAGG + Intronic
969286064 4:6202515-6202537 CTGGGACAGATCCTTCCCCAGGG + Intergenic
969622794 4:8287103-8287125 CTGGGGATGCACCTGCCCCATGG + Intronic
970359174 4:15290946-15290968 CAGAAAAGGCTCATTCCCCAAGG + Intergenic
971180313 4:24324049-24324071 CTGGGAAGGCAGCTTTCCCTTGG + Intergenic
972283063 4:37621755-37621777 CTGGGCAGGGGCCTGCCCCAGGG - Intronic
973004599 4:44991826-44991848 CTGGGAATGATCCTTACCCCTGG + Intergenic
973566963 4:52198643-52198665 CTGGGAAGGCAGTTTCTCCAGGG - Intergenic
976274574 4:83263253-83263275 CTGGGCAGACTCCTACCCCAGGG - Intronic
978200561 4:106019722-106019744 CCCGGAAGGCCCCTTCCTCAAGG - Intergenic
979438458 4:120722454-120722476 CTGGGAAGGGTCCTCCTCCAGGG - Intronic
981106987 4:140892664-140892686 CTTCGCAGGCTCCTTCCCCCTGG + Intronic
984913420 4:184698164-184698186 CTGGGAAGGCTTTTTCTCCATGG - Intronic
985409487 4:189668410-189668432 CAGGGAAGGTGCATTCCCCAGGG - Intergenic
985531441 5:436093-436115 GTGGGAAGGCCCCATCCTCAGGG + Exonic
986388626 5:7264351-7264373 CTGGGAAGGCAGCCTCCCCTTGG + Intergenic
986417247 5:7541527-7541549 CTGGGAAGGCTGTGTCACCAGGG + Intronic
986683948 5:10259606-10259628 CCTGGAATGCTCCTCCCCCAGGG - Intronic
988099508 5:26659187-26659209 CTGAGAAGGCACCATCCACAAGG + Intergenic
988738760 5:34048871-34048893 CTAGGAATGCTCCTGCCACAAGG + Intronic
990243019 5:53834537-53834559 ATGGGAAGGCACCTGCCCCCAGG + Intergenic
992396315 5:76372445-76372467 CTGTGCAGGTGCCTTCCCCACGG + Intergenic
998456930 5:142280797-142280819 CTGGGAAGGCTGAGGCCCCAGGG - Intergenic
1000790894 5:165605849-165605871 TGCGGAAGGCCCCTTCCCCATGG + Intergenic
1001940064 5:175733995-175734017 CTGGTAGGGCTCCACCCCCACGG + Intergenic
1004696337 6:18036893-18036915 CTGGGAAGGCCTCTTCCCCTAGG - Intergenic
1006516377 6:34547936-34547958 TGGGGAATGCTCCGTCCCCAAGG + Intronic
1007281249 6:40713920-40713942 CTGGGAAAGCTCACTCCACAGGG + Intergenic
1007283358 6:40729111-40729133 CTGGGTGGGATCCTGCCCCATGG + Intergenic
1007466842 6:42058518-42058540 GTGGGAGGGCACCTTCCCAACGG - Intronic
1007736328 6:43984582-43984604 CTGGGCACGCTCCTGCCTCAGGG - Intergenic
1009843493 6:69106664-69106686 CTGAAAAGGCACTTTCCCCAAGG + Intronic
1010589026 6:77691431-77691453 CTGGGAAGGCTTCTTACCTCTGG + Intronic
1013357330 6:109357789-109357811 CAGTGAAGGGTCCTTCCTCAAGG - Intergenic
1013409158 6:109868904-109868926 CTGAGTGGGCCCCTTCCCCAAGG + Intergenic
1014794284 6:125706969-125706991 CTGGGAAGGCAGCTTTCCCTTGG - Intergenic
1015266462 6:131296129-131296151 CTGGGAAGGCAGCTTTCCCTTGG + Intergenic
1015366601 6:132402813-132402835 CTGGGAAGGGACTTTTCCCAAGG + Intergenic
1017123587 6:151045898-151045920 CAGGGATGACTCCTTCCCTATGG - Intronic
1018744934 6:166754664-166754686 CTGGAGAGGCTGCTCCCCCAGGG - Intronic
1020076785 7:5263634-5263656 CTGGGCAGGCCCCCGCCCCAGGG - Intergenic
1022419879 7:30210355-30210377 GAGAGAAGGCTTCTTCCCCATGG - Intergenic
1025006592 7:55360463-55360485 CTTGGATGGCTCCTGCCTCATGG - Intergenic
1025202310 7:56969960-56969982 CTGGGCAGGCCCCCGCCCCAGGG + Intergenic
1025669637 7:63606967-63606989 CTGGGCAGGCCCCTGCCCCAGGG - Intergenic
1029315475 7:99709003-99709025 CAGGGAGGGCTCCCTTCCCAGGG + Intronic
1029321199 7:99762009-99762031 CAGGGAGGGCTCCCTTCCCAGGG + Intronic
1029331715 7:99861849-99861871 GAGGGAAGGCTCCTTTCCCAGGG - Intronic
1034556159 7:151851741-151851763 ATGGGAAGCCTCCCTCCTCATGG + Intronic
1034811755 7:154138500-154138522 CTGGGTTGGCTCCTTCCCTGTGG - Intronic
1034921072 7:155082582-155082604 CTGGAAAGTCTCCTTCCCCTTGG - Intronic
1034937683 7:155210380-155210402 CTGGGACGGCCCCTTCCTCATGG + Intergenic
1035601193 8:897835-897857 CGGGGTTGGCTCCTTCCCCCAGG + Intergenic
1036815874 8:11902530-11902552 GTGGGAAGGCTCCTCCCCGCCGG - Intergenic
1037618603 8:20543473-20543495 CTGGGCAGCCTCTTCCCCCAGGG - Intergenic
1038779629 8:30558744-30558766 CTGTGAGGGCCTCTTCCCCAAGG - Intronic
1039650157 8:39332824-39332846 CTGGGAGGGCTCATTCCCCCTGG - Intergenic
1040516483 8:48139453-48139475 CTGGGGAGGCAACTTCCCAAAGG - Intergenic
1040574720 8:48641764-48641786 CTGGGAAGGCTTTCACCCCACGG - Intergenic
1042198659 8:66257875-66257897 CTAGGAACACTCCTTCCCCTAGG - Intergenic
1043425164 8:80141306-80141328 CTGGGTAGGCCCCTTCCACGTGG + Intronic
1043566761 8:81557945-81557967 CTGGGCAGGCTTCCTGCCCAGGG - Intergenic
1044776514 8:95694480-95694502 CTGGAATGTCTCCTTCACCATGG + Intergenic
1046705443 8:117444937-117444959 CTGAGAAAGCTCCTTGTCCAAGG + Intergenic
1047259188 8:123241059-123241081 CTGGGAAAGCCGCTTCCCCGTGG + Intronic
1047294721 8:123560611-123560633 CTGGGAAGGCCCCTTTCCACAGG + Intergenic
1048208901 8:132438527-132438549 CTGGCCAGGCTCCTTACCCAAGG + Intronic
1048669783 8:136704966-136704988 CTGGGAGTGCTCCTTTCCAAAGG - Intergenic
1048837708 8:138537184-138537206 CTGGGAGGGCACCTTTCCCATGG + Intergenic
1049286018 8:141775625-141775647 CACGGAACACTCCTTCCCCAGGG - Intergenic
1049408164 8:142460814-142460836 CTGAGCACTCTCCTTCCCCATGG + Intronic
1052346402 9:27414119-27414141 CTCTGACGGCTGCTTCCCCAGGG + Intronic
1053684938 9:40512012-40512034 CAGGGATGACTCCTTCCCTATGG - Intergenic
1053934899 9:43140295-43140317 CAGGGATGACTCCTTCCCTATGG - Intergenic
1054278789 9:63112944-63112966 CAGGGATGACTCCTTCCCTATGG + Intergenic
1054298029 9:63347475-63347497 CAGGGATGACTCCTTCCCTATGG - Intergenic
1054396047 9:64651993-64652015 CAGGGATGACTCCTTCCCTATGG - Intergenic
1054430690 9:65157188-65157210 CAGGGATGACTCCTTCCCTATGG - Intergenic
1054499689 9:65864333-65864355 CAGGGATGACTCCTTCCCTATGG + Intergenic
1056044969 9:82705493-82705515 CTGGGAAGGCAGCTTTCCCTTGG - Intergenic
1057377737 9:94540631-94540653 CTGGGAAGGCAGCCTCCCCTTGG + Intergenic
1057489154 9:95508384-95508406 CCGGGAAGCCTCCGTCCCCGCGG - Exonic
1058275181 9:103032079-103032101 ATGGCAAGGCTCCTTTCCCCTGG + Intergenic
1058670481 9:107357007-107357029 CTTGGAAGGCTCCCTACCCCTGG + Intergenic
1060203038 9:121663310-121663332 CTGGGTAGGGCCCTTCCGCAAGG - Intronic
1060223098 9:121774684-121774706 CTGGGAAGGCTCCTTAGCCCAGG + Intronic
1060412458 9:123408866-123408888 CAGGGAAGGATCATTCCCCTTGG - Intronic
1060817270 9:126641685-126641707 CTGGGGAGGCTCTTTCTTCAAGG + Intronic
1060903071 9:127278779-127278801 CAAGGAAGGATTCTTCCCCACGG - Intronic
1061164362 9:128913749-128913771 CTGGGAAGGCTCTGGCCCCTGGG + Intronic
1061445683 9:130635930-130635952 CTGGGCAGGACCCTTCCCAAAGG - Intronic
1061543571 9:131290932-131290954 CTGCCCAGGCTTCTTCCCCAGGG + Intronic
1061856757 9:133445718-133445740 GGGAGAAGGCTCCCTCCCCATGG + Exonic
1062111660 9:134785327-134785349 CTTGGAAGGCTCCTTCCTCCCGG + Intronic
1062155610 9:135046565-135046587 CTGGGAATGCTCCTCCCCAGAGG - Intergenic
1062378805 9:136276947-136276969 CTGGGAGGGCTGCAGCCCCACGG + Intergenic
1062404947 9:136391779-136391801 CTGGGCAGGCTCCTTCCCTAGGG + Intronic
1062505982 9:136876808-136876830 GTGGGGAGGCCACTTCCCCATGG - Intronic
1062676159 9:137745612-137745634 CTGGGGTAGCTGCTTCCCCACGG - Intronic
1062732850 9:138119316-138119338 CGGGGGAGGCTCCTTCCACAAGG + Intronic
1185858842 X:3559374-3559396 CTGGGAAGGCAGCCTCCCCTTGG - Intergenic
1187443791 X:19343675-19343697 CTAGGAAGGCTCCTTTCCCGCGG + Intergenic
1187519786 X:20003304-20003326 ATGGGACGGTTACTTCCCCAAGG - Intergenic
1189239658 X:39515688-39515710 CAGGGAAAGCTCCTTCAGCAAGG - Intergenic
1190925749 X:54902233-54902255 CTGGGAACCCTCCTTACACATGG + Intergenic
1194186513 X:90778351-90778373 CTGGGAAGGCAGCTTTCCCTTGG - Intergenic
1194397232 X:93401637-93401659 CTGTGAAGGCTCCATCCCTGAGG - Intergenic
1195426819 X:104742786-104742808 CTGGAAAGGCTCTATCACCATGG - Intronic
1195697715 X:107679067-107679089 CAGGGAAGGGCTCTTCCCCATGG - Intergenic
1198159643 X:133994831-133994853 CTGATAAGGCTGCTTGCCCAAGG - Intergenic
1198432858 X:136585375-136585397 CTGAGAAGGTTCCTCCCACAAGG + Intergenic
1199851972 X:151730278-151730300 CTGGGAAGGGATCTTCTCCATGG - Intergenic
1200533114 Y:4360427-4360449 CTGGGAAGGCAGCTTTCCCTTGG - Intergenic
1201564655 Y:15353550-15353572 ATGCCAAGGCACCTTCCCCATGG - Intergenic