ID: 1066442035

View in Genome Browser
Species Human (GRCh38)
Location 10:35448663-35448685
Sequence CAGCAGAGTGGGCATGCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066442029_1066442035 -3 Left 1066442029 10:35448643-35448665 CCTTGGGGAAGGAGCCTTCCCAG 0: 1
1: 0
2: 4
3: 44
4: 316
Right 1066442035 10:35448663-35448685 CAGCAGAGTGGGCATGCGCCTGG No data
1066442023_1066442035 29 Left 1066442023 10:35448611-35448633 CCTGAAGGATATGAGAGCTGAAC 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1066442035 10:35448663-35448685 CAGCAGAGTGGGCATGCGCCTGG No data
1066442028_1066442035 7 Left 1066442028 10:35448633-35448655 CCATGTGACTCCTTGGGGAAGGA 0: 1
1: 0
2: 0
3: 26
4: 311
Right 1066442035 10:35448663-35448685 CAGCAGAGTGGGCATGCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066442035 Original CRISPR CAGCAGAGTGGGCATGCGCC TGG Intronic
No off target data available for this crispr