ID: 1066445771

View in Genome Browser
Species Human (GRCh38)
Location 10:35481361-35481383
Sequence TCCAGGACATTCTTGGACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066445764_1066445771 8 Left 1066445764 10:35481330-35481352 CCCCAATCTGCAGGCAGTTAGGG 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1066445771 10:35481361-35481383 TCCAGGACATTCTTGGACTTAGG No data
1066445768_1066445771 6 Left 1066445768 10:35481332-35481354 CCAATCTGCAGGCAGTTAGGGGA 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1066445771 10:35481361-35481383 TCCAGGACATTCTTGGACTTAGG No data
1066445766_1066445771 7 Left 1066445766 10:35481331-35481353 CCCAATCTGCAGGCAGTTAGGGG 0: 1
1: 0
2: 1
3: 5
4: 113
Right 1066445771 10:35481361-35481383 TCCAGGACATTCTTGGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066445771 Original CRISPR TCCAGGACATTCTTGGACTT AGG Intronic
No off target data available for this crispr