ID: 1066447371

View in Genome Browser
Species Human (GRCh38)
Location 10:35495845-35495867
Sequence CTCCATGTGCATTCTGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066447364_1066447371 11 Left 1066447364 10:35495811-35495833 CCCTGTCAGGGCAGGAGCTCAGC 0: 1
1: 0
2: 1
3: 30
4: 299
Right 1066447371 10:35495845-35495867 CTCCATGTGCATTCTGAACAGGG No data
1066447365_1066447371 10 Left 1066447365 10:35495812-35495834 CCTGTCAGGGCAGGAGCTCAGCA 0: 1
1: 0
2: 3
3: 25
4: 262
Right 1066447371 10:35495845-35495867 CTCCATGTGCATTCTGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066447371 Original CRISPR CTCCATGTGCATTCTGAACA GGG Intronic
No off target data available for this crispr