ID: 1066448410

View in Genome Browser
Species Human (GRCh38)
Location 10:35505424-35505446
Sequence ATTTGTCTCAACACTGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066448407_1066448410 29 Left 1066448407 10:35505372-35505394 CCAGACTGGGAATTCTGTGTAGT 0: 1
1: 0
2: 0
3: 6
4: 165
Right 1066448410 10:35505424-35505446 ATTTGTCTCAACACTGAGTCTGG No data
1066448408_1066448410 1 Left 1066448408 10:35505400-35505422 CCTCAAAAAAAAAAAAACCAAAG 0: 1
1: 10
2: 941
3: 10859
4: 34090
Right 1066448410 10:35505424-35505446 ATTTGTCTCAACACTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066448410 Original CRISPR ATTTGTCTCAACACTGAGTC TGG Intronic
No off target data available for this crispr