ID: 1066449175

View in Genome Browser
Species Human (GRCh38)
Location 10:35512455-35512477
Sequence CTGAGTAGCCAGAAAGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066449171_1066449175 -6 Left 1066449171 10:35512438-35512460 CCACAAAGGGACTGCGACTGAGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1066449175 10:35512455-35512477 CTGAGTAGCCAGAAAGATGGGGG No data
1066449168_1066449175 28 Left 1066449168 10:35512404-35512426 CCATTACATTTGAGGAAATTCAG 0: 1
1: 0
2: 3
3: 48
4: 414
Right 1066449175 10:35512455-35512477 CTGAGTAGCCAGAAAGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066449175 Original CRISPR CTGAGTAGCCAGAAAGATGG GGG Intronic
No off target data available for this crispr