ID: 1066449237

View in Genome Browser
Species Human (GRCh38)
Location 10:35512813-35512835
Sequence ATTTGAGGAGGTGTCGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066449228_1066449237 11 Left 1066449228 10:35512779-35512801 CCTGTGGGGAGCTCAGCATGGTG No data
Right 1066449237 10:35512813-35512835 ATTTGAGGAGGTGTCGCGGGTGG No data
1066449227_1066449237 12 Left 1066449227 10:35512778-35512800 CCCTGTGGGGAGCTCAGCATGGT No data
Right 1066449237 10:35512813-35512835 ATTTGAGGAGGTGTCGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066449237 Original CRISPR ATTTGAGGAGGTGTCGCGGG TGG Intronic