ID: 1066449323

View in Genome Browser
Species Human (GRCh38)
Location 10:35513774-35513796
Sequence TGTCATTTACTAGCAAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066449318_1066449323 21 Left 1066449318 10:35513730-35513752 CCAAGAGTCATGCCCTGCTGTTT 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1066449323 10:35513774-35513796 TGTCATTTACTAGCAAAGATGGG No data
1066449320_1066449323 8 Left 1066449320 10:35513743-35513765 CCTGCTGTTTCTCCAGCACATCA No data
Right 1066449323 10:35513774-35513796 TGTCATTTACTAGCAAAGATGGG No data
1066449319_1066449323 9 Left 1066449319 10:35513742-35513764 CCCTGCTGTTTCTCCAGCACATC 0: 1
1: 1
2: 10
3: 64
4: 428
Right 1066449323 10:35513774-35513796 TGTCATTTACTAGCAAAGATGGG No data
1066449321_1066449323 -4 Left 1066449321 10:35513755-35513777 CCAGCACATCACTTTGCTGTGTC 0: 1
1: 0
2: 2
3: 15
4: 149
Right 1066449323 10:35513774-35513796 TGTCATTTACTAGCAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066449323 Original CRISPR TGTCATTTACTAGCAAAGAT GGG Intronic
No off target data available for this crispr