ID: 1066452802

View in Genome Browser
Species Human (GRCh38)
Location 10:35546873-35546895
Sequence CCGCAGAGGTCAGTGCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066452802_1066452806 -10 Left 1066452802 10:35546873-35546895 CCAGTGAGCACTGACCTCTGCGG No data
Right 1066452806 10:35546886-35546908 ACCTCTGCGGAGAGCTTGGGAGG No data
1066452802_1066452812 30 Left 1066452802 10:35546873-35546895 CCAGTGAGCACTGACCTCTGCGG No data
Right 1066452812 10:35546926-35546948 TGTAAAGGAGTGGAATCTCTGGG No data
1066452802_1066452808 15 Left 1066452802 10:35546873-35546895 CCAGTGAGCACTGACCTCTGCGG No data
Right 1066452808 10:35546911-35546933 GCAGCGCCTCATGTCTGTAAAGG No data
1066452802_1066452811 29 Left 1066452802 10:35546873-35546895 CCAGTGAGCACTGACCTCTGCGG No data
Right 1066452811 10:35546925-35546947 CTGTAAAGGAGTGGAATCTCTGG No data
1066452802_1066452809 20 Left 1066452802 10:35546873-35546895 CCAGTGAGCACTGACCTCTGCGG No data
Right 1066452809 10:35546916-35546938 GCCTCATGTCTGTAAAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066452802 Original CRISPR CCGCAGAGGTCAGTGCTCAC TGG (reversed) Intronic