ID: 1066452806

View in Genome Browser
Species Human (GRCh38)
Location 10:35546886-35546908
Sequence ACCTCTGCGGAGAGCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066452802_1066452806 -10 Left 1066452802 10:35546873-35546895 CCAGTGAGCACTGACCTCTGCGG No data
Right 1066452806 10:35546886-35546908 ACCTCTGCGGAGAGCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066452806 Original CRISPR ACCTCTGCGGAGAGCTTGGG AGG Intronic