ID: 1066452807

View in Genome Browser
Species Human (GRCh38)
Location 10:35546887-35546909
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066452807_1066452808 1 Left 1066452807 10:35546887-35546909 CCTCTGCGGAGAGCTTGGGAGGT 0: 1
1: 0
2: 1
3: 11
4: 120
Right 1066452808 10:35546911-35546933 GCAGCGCCTCATGTCTGTAAAGG No data
1066452807_1066452812 16 Left 1066452807 10:35546887-35546909 CCTCTGCGGAGAGCTTGGGAGGT 0: 1
1: 0
2: 1
3: 11
4: 120
Right 1066452812 10:35546926-35546948 TGTAAAGGAGTGGAATCTCTGGG No data
1066452807_1066452809 6 Left 1066452807 10:35546887-35546909 CCTCTGCGGAGAGCTTGGGAGGT 0: 1
1: 0
2: 1
3: 11
4: 120
Right 1066452809 10:35546916-35546938 GCCTCATGTCTGTAAAGGAGTGG No data
1066452807_1066452811 15 Left 1066452807 10:35546887-35546909 CCTCTGCGGAGAGCTTGGGAGGT 0: 1
1: 0
2: 1
3: 11
4: 120
Right 1066452811 10:35546925-35546947 CTGTAAAGGAGTGGAATCTCTGG No data
1066452807_1066452813 22 Left 1066452807 10:35546887-35546909 CCTCTGCGGAGAGCTTGGGAGGT 0: 1
1: 0
2: 1
3: 11
4: 120
Right 1066452813 10:35546932-35546954 GGAGTGGAATCTCTGGGATCTGG No data
1066452807_1066452814 23 Left 1066452807 10:35546887-35546909 CCTCTGCGGAGAGCTTGGGAGGT 0: 1
1: 0
2: 1
3: 11
4: 120
Right 1066452814 10:35546933-35546955 GAGTGGAATCTCTGGGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066452807 Original CRISPR ACCTCCCAAGCTCTCCGCAG AGG (reversed) Intronic