ID: 1066452809

View in Genome Browser
Species Human (GRCh38)
Location 10:35546916-35546938
Sequence GCCTCATGTCTGTAAAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066452807_1066452809 6 Left 1066452807 10:35546887-35546909 CCTCTGCGGAGAGCTTGGGAGGT No data
Right 1066452809 10:35546916-35546938 GCCTCATGTCTGTAAAGGAGTGG No data
1066452802_1066452809 20 Left 1066452802 10:35546873-35546895 CCAGTGAGCACTGACCTCTGCGG No data
Right 1066452809 10:35546916-35546938 GCCTCATGTCTGTAAAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066452809 Original CRISPR GCCTCATGTCTGTAAAGGAG TGG Intronic