ID: 1066452811 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:35546925-35546947 |
Sequence | CTGTAAAGGAGTGGAATCTC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1066452802_1066452811 | 29 | Left | 1066452802 | 10:35546873-35546895 | CCAGTGAGCACTGACCTCTGCGG | No data | ||
Right | 1066452811 | 10:35546925-35546947 | CTGTAAAGGAGTGGAATCTCTGG | No data | ||||
1066452807_1066452811 | 15 | Left | 1066452807 | 10:35546887-35546909 | CCTCTGCGGAGAGCTTGGGAGGT | No data | ||
Right | 1066452811 | 10:35546925-35546947 | CTGTAAAGGAGTGGAATCTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1066452811 | Original CRISPR | CTGTAAAGGAGTGGAATCTC TGG | Intronic | ||