ID: 1066452887

View in Genome Browser
Species Human (GRCh38)
Location 10:35547689-35547711
Sequence CATCCACACAGGGCTCCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066452887_1066452900 27 Left 1066452887 10:35547689-35547711 CCTGCCGGAGCCCTGTGTGGATG 0: 1
1: 0
2: 2
3: 11
4: 166
Right 1066452900 10:35547739-35547761 CATATGCCCATGATGCATTCAGG No data
1066452887_1066452892 0 Left 1066452887 10:35547689-35547711 CCTGCCGGAGCCCTGTGTGGATG 0: 1
1: 0
2: 2
3: 11
4: 166
Right 1066452892 10:35547712-35547734 CGGTCCCTTGTCGTCCCTGCAGG No data
1066452887_1066452901 28 Left 1066452887 10:35547689-35547711 CCTGCCGGAGCCCTGTGTGGATG 0: 1
1: 0
2: 2
3: 11
4: 166
Right 1066452901 10:35547740-35547762 ATATGCCCATGATGCATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066452887 Original CRISPR CATCCACACAGGGCTCCGGC AGG (reversed) Intronic
901814311 1:11785199-11785221 CATCCTCACCCAGCTCCGGCCGG + Exonic
904360031 1:29965263-29965285 CATCCACACAGTCCTGTGGCTGG - Intergenic
907985495 1:59525384-59525406 CAGCCACAGAGGTTTCCGGCTGG + Intronic
912263366 1:108131009-108131031 CAGCCACACGGGCCTCCTGCAGG + Intergenic
915070269 1:153260823-153260845 CATCCTCCCAGGGCTCCTTCAGG - Intronic
916037414 1:160933550-160933572 CTTCCACACAGGGCGGCGGCTGG - Intergenic
921675392 1:217969758-217969780 CAGCCACAGAGGTTTCCGGCTGG + Intergenic
922054631 1:222028997-222029019 CATGCAGACAGGGCACAGGCTGG + Intergenic
924774123 1:247103959-247103981 GTTCCCGACAGGGCTCCGGCCGG + Exonic
1063349860 10:5344134-5344156 CATCCACACTGGGCTGGTGCTGG + Intergenic
1065325232 10:24544970-24544992 CCTTCCCACAGGGCTCCAGCGGG + Exonic
1066452887 10:35547689-35547711 CATCCACACAGGGCTCCGGCAGG - Intronic
1067239280 10:44476596-44476618 CATTCACAGAGGGCTGAGGCCGG - Intergenic
1068474580 10:57508140-57508162 CAGCCACACAGGTTTCTGGCTGG + Intergenic
1070279159 10:75036420-75036442 CATGCACACAGGGCTTGGGGGGG - Intergenic
1071819201 10:89263661-89263683 CAGCCACACAGGCTTCTGGCTGG - Intronic
1073163324 10:101420513-101420535 CATCCACACAGGGCAGTGGAGGG - Intronic
1073168874 10:101484103-101484125 CATCCACAAAGGGCTACTGAAGG - Intronic
1073845233 10:107546095-107546117 CAGCCACAGAGGTTTCCGGCTGG + Intergenic
1074432996 10:113409326-113409348 CATTTACACAGCGCGCCGGCAGG + Intergenic
1077134771 11:993037-993059 CATCCACAACAGGCTCTGGCTGG - Intronic
1077155547 11:1089359-1089381 CAGCCAGCCAGGGCCCCGGCAGG - Intergenic
1077350559 11:2091284-2091306 CAGCCCCACAGGCCTCCGACCGG - Intergenic
1081100628 11:38997270-38997292 CATCCTCCCAGTGCTCAGGCTGG + Intergenic
1084912582 11:72402931-72402953 CTTCCACACAGGGCTCCTTTAGG - Intronic
1085872545 11:80367639-80367661 TATATACACAGGGCACCGGCAGG - Intergenic
1087324996 11:96710762-96710784 AATACACACAGGGCTGTGGCTGG - Intergenic
1088527914 11:110776483-110776505 CACACACACAGGGCACAGGCTGG - Intergenic
1090260141 11:125313475-125313497 AATCCTCACAGAGCTCCTGCTGG + Intronic
1094393442 12:29978441-29978463 CAGCCACACAGGGCACCGTGAGG - Intergenic
1103717048 12:122950818-122950840 CATCGAGCCAGGGCTCCTGCAGG + Intronic
1103777785 12:123379379-123379401 CAACTACACAGGGCTCTGGGAGG - Intergenic
1105612406 13:21980535-21980557 CATCCACACAGGGCACCCTGAGG + Intergenic
1109003324 13:56835297-56835319 CTTCCACACAGGGTTCCCACTGG - Intergenic
1109562698 13:64074951-64074973 CAGCCACAGAGGTTTCCGGCTGG - Intergenic
1110707006 13:78608106-78608128 CATTCAGACTGGGCTCCAGCTGG + Intergenic
1111485850 13:88896835-88896857 CAGCCACACAGGCTTCTGGCTGG + Intergenic
1112760603 13:102690038-102690060 CATCCTCTCAGGGCTGTGGCAGG + Intronic
1113715295 13:112501420-112501442 TGTCCACACAGGGCACCTGCAGG + Intronic
1113910904 13:113840820-113840842 TAGCCACACAGGGCTCCGTGGGG + Intronic
1116056230 14:39866787-39866809 CCTCCACCTAGGCCTCCGGCAGG - Intergenic
1116336655 14:43665825-43665847 GATCCACAGAGGCCTCCAGCAGG + Intergenic
1118048404 14:61998365-61998387 TATCCACACAGGTCTGGGGCTGG - Intronic
1118063310 14:62164291-62164313 CATGCACACAGGGCCCCAGGAGG + Intergenic
1121224563 14:92311869-92311891 CATCCCCATAGGGCACCTGCTGG - Intergenic
1121781376 14:96624512-96624534 CCTCCACACAGGGCTCTGGCTGG + Intergenic
1122969784 14:105147850-105147872 CATTCACACAGGGGTTGGGCAGG + Exonic
1122995583 14:105262099-105262121 CACCCACACAGGAGCCCGGCAGG + Intronic
1125113912 15:36066842-36066864 CAGCCACAAAGGGTTCCAGCTGG - Intergenic
1132675429 16:1119369-1119391 CATCCACACAGAGCCGCGCCGGG - Intergenic
1136716938 16:32288897-32288919 CCTGCACACAGGGCTCCTCCTGG + Intergenic
1136835313 16:33495142-33495164 CCTGCACACAGGGCTCCTCCTGG + Intergenic
1137477921 16:48826833-48826855 CATCCACACAATGATCCTGCAGG - Intergenic
1139433425 16:66923343-66923365 CCTGCTCACAGGGCTCCGGAAGG - Intronic
1140835591 16:78791081-78791103 CCTCCACACAGGGCCCCTGAAGG + Intronic
1141513369 16:84526805-84526827 CCTGCACACAGGGCTGCGGTGGG - Intronic
1141815694 16:86408066-86408088 CTTCTACAAAGGGCTCCTGCCGG - Intergenic
1203009490 16_KI270728v1_random:228890-228912 CCTGCACACAGGGCTCCTCCTGG - Intergenic
1203145486 16_KI270728v1_random:1795463-1795485 CCTGCACACAGGGCTCCTCCTGG + Intergenic
1143041720 17:4043049-4043071 CATTTAAACAGGGCTCAGGCAGG - Intronic
1144872377 17:18379175-18379197 CATCCACAGAGAGCTGAGGCTGG - Intronic
1144873585 17:18384827-18384849 CATCCACAGAGAGCTGAGGCTGG - Intronic
1145245753 17:21268349-21268371 CACCCTCACAGAGCTCTGGCAGG - Intergenic
1147684318 17:42277485-42277507 CAGCCACAAAGGTCTCCAGCTGG + Intergenic
1148061678 17:44841022-44841044 AATCCACATGGGGCTCAGGCAGG + Intergenic
1151633721 17:75329109-75329131 AATCCACACATGGCCTCGGCTGG + Intronic
1151905109 17:77042759-77042781 CAACTACACAGGGCTCTGGCTGG - Intergenic
1152551331 17:81031900-81031922 CATGCACACAGGGCGCCGAGCGG - Intergenic
1152599540 17:81255043-81255065 CACCCACACAGAGCTCCCCCTGG - Intronic
1152629477 17:81403860-81403882 ATTCCAAACAGGGCTTCGGCGGG - Intronic
1153526092 18:5995979-5996001 CAGCCACACACGCCTCCAGCTGG - Intronic
1157202370 18:45669805-45669827 CATCCACAAAGAGCCCAGGCTGG - Intronic
1157476401 18:48026395-48026417 CATCCGGAATGGGCTCCGGCTGG - Intergenic
1160247842 18:77173913-77173935 CATCCACAGAGGGCTACGTGTGG + Intergenic
1162525530 19:11204084-11204106 CTTCCCCACAGAGTTCCGGCTGG - Exonic
1163359707 19:16837932-16837954 CATCCACACACAGCCCCGCCTGG - Intronic
1164984584 19:32638977-32638999 CAGCCACAGAGGTTTCCGGCTGG + Intronic
1165373356 19:35424388-35424410 CATCCACAGAGGTCTCCTGCAGG + Intergenic
1165732236 19:38153159-38153181 CGTCCAGACAGGGCATCGGCAGG + Intronic
1167158848 19:47755063-47755085 CTTCCAGGCAGGGCTCGGGCTGG + Intronic
925204310 2:1993277-1993299 CAGGCACACAGGGGTCCGCCAGG + Intronic
927789891 2:26001836-26001858 CAACCAGTCAGGGCTCCAGCTGG - Intergenic
928088450 2:28359941-28359963 CCTGCACACAGGCCTCAGGCTGG - Intergenic
929808779 2:45170360-45170382 CATGCACACAAGGCGCCCGCGGG - Intergenic
931247748 2:60505476-60505498 CATCCACACAGGGAACAAGCGGG + Intronic
933761919 2:85678520-85678542 AAGCCACACAGGCCTCTGGCAGG + Intergenic
934560447 2:95310503-95310525 CAGCCCCACAGGGCTCAGGTAGG + Exonic
934966779 2:98730864-98730886 CCCCCGCACAGAGCTCCGGCCGG + Intronic
937334942 2:121056474-121056496 CATCCCCACTGGCCTCCTGCTGG - Intergenic
937370684 2:121295400-121295422 CAGCCACAGAGGTCTCTGGCTGG - Intergenic
938839336 2:135143998-135144020 CAGCCACAGAGGGCCCCAGCGGG - Intronic
1172322020 20:34002772-34002794 CACCCACACAGTTCTCTGGCTGG + Intronic
1172910846 20:38407732-38407754 CATCCAGACGGGGCGGCGGCCGG - Intergenic
1173620106 20:44430068-44430090 CAGCCTCACAGGGCTCTGTCTGG - Exonic
1174544133 20:51312588-51312610 CATCCTCCCAGTGCTCAGGCAGG + Intergenic
1174598346 20:51702942-51702964 CCTCCTAACAGGCCTCCGGCAGG + Intronic
1175819606 20:61901639-61901661 CGTCCACACCGGGCTCCGGCCGG + Intronic
1175940891 20:62537054-62537076 CCTCCACACAGGCCTCCTCCTGG - Intergenic
1176035544 20:63034753-63034775 CATCCAGGCAGGACTCCGCCAGG + Intergenic
1176056791 20:63153045-63153067 CAGCCACACTGGGCACAGGCAGG - Intergenic
1176076712 20:63251932-63251954 CTTCCCCCCGGGGCTCCGGCAGG - Intronic
1176187993 20:63791985-63792007 CCTCCACACAGAACGCCGGCTGG - Intronic
1177546279 21:22562286-22562308 CAGCCGCAGAGGTCTCCGGCTGG + Intergenic
1180183966 21:46130418-46130440 CATCCAGGCTGGGCTCCTGCCGG + Intronic
1180846277 22:18984189-18984211 CATCCACGCAGGGCCCCCACAGG + Intergenic
1181273290 22:21673336-21673358 CAGCCACACAGGGCACAGGCAGG - Intronic
1182287613 22:29257628-29257650 CTTCCACCCAGGTCTCCTGCAGG - Intronic
1183200592 22:36383397-36383419 CCTCTTCACAGGGCCCCGGCTGG - Intronic
1183299800 22:37053247-37053269 CCTCCACAGAGGGCCCTGGCAGG - Intronic
1183783901 22:40018200-40018222 GATCCAGGCAGAGCTCCGGCTGG - Intronic
1184328925 22:43813229-43813251 CTTGCACACATGGCTGCGGCAGG + Intergenic
1184688066 22:46105258-46105280 CAACCCCACAGGGCTCCCACAGG - Intronic
1184754532 22:46508482-46508504 CAGCAACAAAGGGCTCTGGCAGG - Intronic
952831379 3:37567987-37568009 CCTCCACACAGAACTCCTGCTGG - Intronic
954604291 3:51896797-51896819 AAACCACACAGGGCTGGGGCTGG - Intronic
955353916 3:58214981-58215003 CTTCCACACAGGGCTGTGCCTGG + Intergenic
957156646 3:76552029-76552051 CAGCCACAGAGGTTTCCGGCTGG + Intronic
958161075 3:89817784-89817806 CAGCCACACAGGTTTCCAGCTGG - Intergenic
961812261 3:129528647-129528669 CAGCCACTCAGGGCTCCAGCTGG - Exonic
967506900 3:190262814-190262836 CATCCACACAAGAATCAGGCAGG + Intergenic
968548630 4:1211157-1211179 CATCCACACAACGGCCCGGCTGG + Intergenic
968727636 4:2255694-2255716 AATCCACACAGGGTTCCTTCAGG - Intronic
969053279 4:4387154-4387176 CACCCACGCCCGGCTCCGGCAGG - Exonic
969588375 4:8107534-8107556 CAGCCACACAGGACCCGGGCAGG + Intronic
973068598 4:45828736-45828758 CATCCACACAGAGCTCAACCAGG - Intergenic
974615399 4:64272814-64272836 CAGCCACACAGGTTTCTGGCTGG + Intergenic
977910011 4:102523442-102523464 CACTCACACAGTGCTCCAGCAGG + Intronic
978944081 4:114472957-114472979 CAGCCACAGAGGTTTCCGGCTGG + Intergenic
982959740 4:161822232-161822254 CATCCACAGAGGTTTCTGGCTGG - Intronic
983287641 4:165760204-165760226 CATCCACCCACTGCTCTGGCAGG + Intergenic
983352064 4:166602430-166602452 CAGCCACAGAGGTCTCCAGCTGG + Intergenic
985571127 5:645889-645911 CGTCCACACAGGCCGCCGACGGG - Intronic
985571135 5:645954-645976 CATCCACACAGGGCGCCAACGGG - Intronic
985609329 5:878183-878205 CATCCACACAGGTCTGCCACAGG - Intronic
986253430 5:6081952-6081974 TCACCACACAGGGCTCAGGCAGG + Intergenic
986461705 5:7979343-7979365 CTTCCACACAGGGGTCAGCCAGG + Intergenic
991039208 5:62158901-62158923 CATCCAGACAGAGTTCCTGCTGG + Intergenic
993002341 5:82394137-82394159 CCTCCACACAGCGCTCAGCCTGG - Intergenic
994355840 5:98793153-98793175 CATCCACAAAGGCGGCCGGCAGG - Exonic
1000610221 5:163365485-163365507 CAGCCACAGAGGTCTCCAGCTGG + Intergenic
1005456818 6:26028034-26028056 CATCCTCTTAGGGCTCTGGCTGG - Intergenic
1005944782 6:30587355-30587377 CCACCACACTGGGCTCAGGCTGG - Intronic
1009699762 6:67161086-67161108 CATCCACACAGAGCTCCCACTGG + Intergenic
1012649583 6:101736309-101736331 CATCCACACAGAGCCCCTACTGG - Intronic
1017507443 6:155081578-155081600 CATTCACACAGAGCCCAGGCAGG + Intronic
1019590408 7:1827715-1827737 CAGCCACGCAGGGCTCAGGAGGG - Intronic
1022392040 7:29951457-29951479 CAGCCACAGAGGTTTCCGGCTGG + Intronic
1023934627 7:44730497-44730519 CAACCACAGAGGTCTCCGGCTGG + Intergenic
1028140930 7:87274139-87274161 CACCCACACAGGGTCCCCGCTGG - Intergenic
1032648975 7:133857433-133857455 CAGCCACAGAGGGTTCTGGCTGG - Intronic
1035451053 7:158977085-158977107 CAGCCACAGAGGTTTCCGGCCGG + Intergenic
1035754676 8:2022546-2022568 CCTCCACCCTGGGCTCAGGCTGG - Intergenic
1035883712 8:3269383-3269405 CAACCACACAGGCTTACGGCTGG + Intronic
1036500999 8:9313790-9313812 CTTGGACCCAGGGCTCCGGCTGG + Intergenic
1038523337 8:28252368-28252390 CATCCACAGGGGACTCAGGCTGG + Intergenic
1039061277 8:33573949-33573971 CATCCACCCAGAACTCCAGCTGG - Intergenic
1040865909 8:52048899-52048921 CGTCCTCACATGGCTCCTGCTGG + Intergenic
1041313990 8:56542958-56542980 CATCCACACAGGCTTCCTGGAGG - Intergenic
1041778708 8:61554158-61554180 CATGCCCACAGGGCCCTGGCAGG + Intronic
1042838561 8:73100398-73100420 CACCCACACAGGGCTGCTGCTGG - Intronic
1043082392 8:75783627-75783649 CAGCCACAGAGGCTTCCGGCTGG - Intergenic
1047510713 8:125513300-125513322 CAAACACACATGGCTCCGGCGGG + Intergenic
1049709429 8:144056973-144056995 CATCCACACACTGCTCCTCCAGG + Exonic
1049804461 8:144532640-144532662 CATCCACCCAGGGAGCCAGCAGG - Intronic
1049854139 8:144851053-144851075 CATGCACACACTGCTCCAGCAGG - Exonic
1053484629 9:38442556-38442578 CATCCACACAGAGCCCTGGAAGG + Intergenic
1055315308 9:75028388-75028410 CATCCGCGCTGGGCTCCGCCAGG + Exonic
1055729796 9:79268750-79268772 CATGCCCACAGGGCTCCTTCAGG - Intergenic
1061475770 9:130865050-130865072 AAACCACACAGGTCTCCAGCAGG - Intronic
1061481751 9:130900867-130900889 CGTCCACACAGGCCTCTGGCTGG - Intergenic
1061597652 9:131642578-131642600 TATCCAAACAGGCCTCCTGCAGG - Intronic
1062506998 9:136882622-136882644 CAGCCACCCAGGCCTCCAGCAGG - Intronic
1062577851 9:137216865-137216887 CACTCCCACAGGGCTCAGGCTGG + Exonic
1062635270 9:137487306-137487328 CATCCACACCGGGCCCTGGTCGG + Intronic
1190908555 X:54751156-54751178 CAGCCACATAGAGCTCCAGCTGG + Exonic
1192576529 X:72247346-72247368 CAGCGACACTGGGCTCTGGCTGG - Intronic
1198107555 X:133475963-133475985 CACCCACCCAGGGCACTGGCAGG - Intergenic
1200009275 X:153109071-153109093 CATCCACACAGTGACCCAGCTGG + Intergenic
1200030325 X:153290851-153290873 CATCCACACAGTGACCCAGCTGG - Intergenic
1200139796 X:153894190-153894212 CTTCCACGCAGTGCACCGGCTGG + Intronic