ID: 1066458291

View in Genome Browser
Species Human (GRCh38)
Location 10:35590839-35590861
Sequence ATATGAGGAGGTGGGGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066458291_1066458305 19 Left 1066458291 10:35590839-35590861 CCAAAGGCCCCACCTCCTCATAT No data
Right 1066458305 10:35590881-35590903 GGATTTCAACATATGGATTTGGG No data
1066458291_1066458301 -2 Left 1066458291 10:35590839-35590861 CCAAAGGCCCCACCTCCTCATAT No data
Right 1066458301 10:35590860-35590882 ATCACATCACCTTGGGGGTTAGG No data
1066458291_1066458296 -10 Left 1066458291 10:35590839-35590861 CCAAAGGCCCCACCTCCTCATAT No data
Right 1066458296 10:35590852-35590874 CTCCTCATATCACATCACCTTGG No data
1066458291_1066458300 -7 Left 1066458291 10:35590839-35590861 CCAAAGGCCCCACCTCCTCATAT No data
Right 1066458300 10:35590855-35590877 CTCATATCACATCACCTTGGGGG No data
1066458291_1066458299 -8 Left 1066458291 10:35590839-35590861 CCAAAGGCCCCACCTCCTCATAT No data
Right 1066458299 10:35590854-35590876 CCTCATATCACATCACCTTGGGG No data
1066458291_1066458297 -9 Left 1066458291 10:35590839-35590861 CCAAAGGCCCCACCTCCTCATAT No data
Right 1066458297 10:35590853-35590875 TCCTCATATCACATCACCTTGGG No data
1066458291_1066458304 18 Left 1066458291 10:35590839-35590861 CCAAAGGCCCCACCTCCTCATAT No data
Right 1066458304 10:35590880-35590902 AGGATTTCAACATATGGATTTGG No data
1066458291_1066458306 20 Left 1066458291 10:35590839-35590861 CCAAAGGCCCCACCTCCTCATAT No data
Right 1066458306 10:35590882-35590904 GATTTCAACATATGGATTTGGGG No data
1066458291_1066458303 12 Left 1066458291 10:35590839-35590861 CCAAAGGCCCCACCTCCTCATAT No data
Right 1066458303 10:35590874-35590896 GGGGTTAGGATTTCAACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066458291 Original CRISPR ATATGAGGAGGTGGGGCCTT TGG (reversed) Intergenic