ID: 1066458668

View in Genome Browser
Species Human (GRCh38)
Location 10:35594502-35594524
Sequence GAGCTTGGTAATTGCATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066458665_1066458668 15 Left 1066458665 10:35594464-35594486 CCTACTTTGTTGTTTGTCTTTGC No data
Right 1066458668 10:35594502-35594524 GAGCTTGGTAATTGCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066458668 Original CRISPR GAGCTTGGTAATTGCATTGC TGG Intergenic
No off target data available for this crispr