ID: 1066461030

View in Genome Browser
Species Human (GRCh38)
Location 10:35612333-35612355
Sequence GTTTAAGTGTGTGCACGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066461024_1066461030 20 Left 1066461024 10:35612290-35612312 CCTCTTAATTACAATCATTTTAA No data
Right 1066461030 10:35612333-35612355 GTTTAAGTGTGTGCACGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066461030 Original CRISPR GTTTAAGTGTGTGCACGTTG GGG Intergenic
No off target data available for this crispr