ID: 1066461044

View in Genome Browser
Species Human (GRCh38)
Location 10:35612490-35612512
Sequence TCTGGCTTGACACGTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066461040_1066461044 18 Left 1066461040 10:35612449-35612471 CCCAGGGCAATCTGTAGGTGGAT No data
Right 1066461044 10:35612490-35612512 TCTGGCTTGACACGTGCAGCTGG No data
1066461041_1066461044 17 Left 1066461041 10:35612450-35612472 CCAGGGCAATCTGTAGGTGGATT No data
Right 1066461044 10:35612490-35612512 TCTGGCTTGACACGTGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066461044 Original CRISPR TCTGGCTTGACACGTGCAGC TGG Intergenic