ID: 1066463034

View in Genome Browser
Species Human (GRCh38)
Location 10:35628942-35628964
Sequence TATAGCACCCCAAATGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066463034_1066463039 21 Left 1066463034 10:35628942-35628964 CCTGCACCATTTGGGGTGCTATA No data
Right 1066463039 10:35628986-35629008 CAATGACATATGTAGGTCTTTGG No data
1066463034_1066463038 14 Left 1066463034 10:35628942-35628964 CCTGCACCATTTGGGGTGCTATA No data
Right 1066463038 10:35628979-35629001 CCTTTGTCAATGACATATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066463034 Original CRISPR TATAGCACCCCAAATGGTGC AGG (reversed) Intergenic
No off target data available for this crispr