ID: 1066464891

View in Genome Browser
Species Human (GRCh38)
Location 10:35642343-35642365
Sequence TTGGCTCGCGGGGCTGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 463}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066464891_1066464905 -4 Left 1066464891 10:35642343-35642365 CCGCCCCCAGCCCCGCGAGCCAA 0: 1
1: 0
2: 0
3: 38
4: 463
Right 1066464905 10:35642362-35642384 CCAATCGCCGGGCGGTAGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1066464891_1066464903 -7 Left 1066464891 10:35642343-35642365 CCGCCCCCAGCCCCGCGAGCCAA 0: 1
1: 0
2: 0
3: 38
4: 463
Right 1066464903 10:35642359-35642381 GAGCCAATCGCCGGGCGGTAGGG 0: 1
1: 0
2: 0
3: 2
4: 22
1066464891_1066464902 -8 Left 1066464891 10:35642343-35642365 CCGCCCCCAGCCCCGCGAGCCAA 0: 1
1: 0
2: 0
3: 38
4: 463
Right 1066464902 10:35642358-35642380 CGAGCCAATCGCCGGGCGGTAGG 0: 1
1: 0
2: 0
3: 3
4: 17
1066464891_1066464907 14 Left 1066464891 10:35642343-35642365 CCGCCCCCAGCCCCGCGAGCCAA 0: 1
1: 0
2: 0
3: 38
4: 463
Right 1066464907 10:35642380-35642402 GGCGGAGTCCACGCGCTCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 83
1066464891_1066464908 15 Left 1066464891 10:35642343-35642365 CCGCCCCCAGCCCCGCGAGCCAA 0: 1
1: 0
2: 0
3: 38
4: 463
Right 1066464908 10:35642381-35642403 GCGGAGTCCACGCGCTCCCAGGG 0: 1
1: 0
2: 1
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066464891 Original CRISPR TTGGCTCGCGGGGCTGGGGG CGG (reversed) Intergenic
900091899 1:924341-924363 TTGGGTCGCGGGGGCCGGGGAGG - Intergenic
900121422 1:1050049-1050071 GGGGCTCTCGGGGCAGGGGGGGG + Intronic
900291741 1:1926575-1926597 GTGGGCCGTGGGGCTGGGGGAGG + Intronic
900394180 1:2446390-2446412 AGGTCTCCCGGGGCTGGGGGTGG + Intronic
900535058 1:3172771-3172793 GTGGCTGCCGGGGCTGGGGGAGG + Intronic
900980947 1:6045791-6045813 CTGGCACGCGGGGATGGTGGAGG + Intronic
901810972 1:11766626-11766648 CAGGCTGGCTGGGCTGGGGGTGG - Intronic
902220098 1:14959176-14959198 TTGGCTCTAGGGGCGGGTGGGGG - Intronic
902226463 1:14999499-14999521 CTGGATGGCGGGGCGGGGGGAGG - Intronic
904285422 1:29450479-29450501 GTGGCTTGCAGGGCTGTGGGTGG - Intergenic
904613466 1:31737616-31737638 CTGGCTCTTGTGGCTGGGGGAGG - Intronic
904921554 1:34012157-34012179 GTGGCTCGTGGGGATGGGTGGGG - Intronic
905524887 1:38629296-38629318 TTGGGGTGGGGGGCTGGGGGAGG - Intergenic
905642899 1:39604003-39604025 GTGGCTGGCTGGGGTGGGGGGGG - Intergenic
905775613 1:40665544-40665566 TAGGCACGCGGGGCGGGGAGGGG + Exonic
905995951 1:42380733-42380755 TTGGCTGGCGGGGCCGACGGCGG + Intergenic
906410407 1:45574167-45574189 TTAACTAGCGGGGCTGGGGGAGG + Intergenic
907091445 1:51729571-51729593 CTGGGTCGCGGGTCTGGGCGGGG + Intronic
907777897 1:57536782-57536804 TAGGCTGGCGGGGGTGGGAGTGG - Intronic
907968900 1:59361385-59361407 TAGGATCGAGGGGCTCGGGGAGG + Intronic
907974921 1:59422401-59422423 TTGACTTGCTGGGCTGGGCGTGG + Intronic
908171931 1:61513390-61513412 GTGGCTACAGGGGCTGGGGGTGG - Intergenic
909916772 1:81329281-81329303 TTGGTTGGTGGGGTTGGGGGTGG - Intronic
910445525 1:87295848-87295870 TTTGCTCAAGGGGCTGTGGGCGG + Intergenic
914753161 1:150549332-150549354 GTGGCGGGCGGGGCTGGGCGGGG + Intergenic
915102532 1:153510809-153510831 TTGGCTCTTTGGGCTGGGTGCGG - Intergenic
915414395 1:155729531-155729553 TTGGCTCACGAGGCTGAGGTGGG + Intronic
916053687 1:161052990-161053012 TTGGCCTGGTGGGCTGGGGGTGG + Intronic
916068232 1:161153486-161153508 TGGGGGCTCGGGGCTGGGGGAGG + Intronic
917578538 1:176349458-176349480 TTGGCTGGCACTGCTGGGGGAGG + Intergenic
917617070 1:176756852-176756874 TTTGGCGGCGGGGCTGGGGGAGG - Intronic
917699238 1:177563457-177563479 GTGGGTTGCGGGGATGGGGGAGG - Intergenic
920739394 1:208565979-208566001 TTGGCTGGTGGGGTTGGGGGAGG + Intergenic
922363010 1:224840106-224840128 CTGGCTGGCAGGGGTGGGGGGGG + Intergenic
922467978 1:225857371-225857393 CTGGCCGGCGGGGCGGGGGGGGG + Intronic
922880571 1:228977427-228977449 CTGGTCCGCAGGGCTGGGGGAGG + Intergenic
923751680 1:236752494-236752516 TTTTCTTGCGGGGGTGGGGGCGG + Intronic
924740819 1:246793475-246793497 CTGGCTCCCAGGGCTGGAGGGGG + Intergenic
924740858 1:246793629-246793651 CTGGCTCCCAGGGCTGGAGGGGG + Intergenic
924740880 1:246793707-246793729 GTGGCTCCCAGGGCTGGAGGGGG + Intergenic
1062850736 10:740621-740643 TGGGTGCCCGGGGCTGGGGGAGG - Intergenic
1064948404 10:20818297-20818319 CTGGGTGGGGGGGCTGGGGGTGG + Intronic
1065343310 10:24724878-24724900 GAGCCTCGCGGGGCTGGAGGGGG + Intergenic
1065367726 10:24952228-24952250 GTGGCTCGCGGGGATGGGGACGG + Intronic
1066124641 10:32328716-32328738 TTGTCACACGGGGCTGTGGGGGG + Intronic
1066464891 10:35642343-35642365 TTGGCTCGCGGGGCTGGGGGCGG - Intergenic
1067025089 10:42837342-42837364 TTGGCGCGCGGGGCGTGGCGCGG - Intergenic
1067343017 10:45419505-45419527 CTGGCCTGCGGGGCTGGGGGAGG - Intronic
1068013441 10:51483309-51483331 ATGGCTCAGGGGGCTGGGTGCGG - Intronic
1068429521 10:56913354-56913376 TTGGGTGGGGGGGCAGGGGGTGG - Intergenic
1068516464 10:58031421-58031443 TTGGGTAGGGGGGCTAGGGGAGG - Intergenic
1069787902 10:71001138-71001160 TTGGCTCACGTGGCTTTGGGTGG + Intergenic
1071573831 10:86711814-86711836 TTGGCCCGCGGGCCGGGCGGCGG + Intronic
1072160450 10:92761286-92761308 CTGGCTCAAGGGGCTGGGCGTGG - Intergenic
1073037091 10:100571629-100571651 CTTGCATGCGGGGCTGGGGGTGG - Intergenic
1073076420 10:100827844-100827866 GCGGCAGGCGGGGCTGGGGGCGG - Exonic
1074584342 10:114752584-114752606 TTGGCAGGTGGGGTTGGGGGAGG - Intergenic
1075010251 10:118862495-118862517 TTAGCTTTCAGGGCTGGGGGAGG - Intergenic
1075906315 10:126084768-126084790 TTGGCTCGCAGGCTTGGGGATGG - Intronic
1076372506 10:129964442-129964464 GGGGCTCGCGGGGCTCGGGCCGG - Intergenic
1076614384 10:131746489-131746511 TTGGCTTGGGGGGTGGGGGGCGG - Intergenic
1076723875 10:132404549-132404571 TTGGCTCTGGGGGCTGGTGCGGG + Intronic
1077021966 11:420910-420932 GGGGCTCCCGGGGCTGGGCGGGG + Intronic
1077108308 11:851266-851288 TTTGCTGGCTGGGCTGGGGGAGG + Intronic
1077225286 11:1436815-1436837 TTGGCATGCAGGGCTGCGGGTGG + Intronic
1077377747 11:2213160-2213182 TTGGCCGGAGGGGCTGGAGGAGG - Intergenic
1077828388 11:5835704-5835726 GTGGCATGGGGGGCTGGGGGAGG - Intronic
1078064699 11:8070705-8070727 TTGGCTTGCGGGGCAGGGATGGG + Intronic
1078514349 11:12009372-12009394 TGGGCGGGCGGGGCTCGGGGCGG - Intronic
1078538178 11:12192041-12192063 GTGGCGGGCGGGGGTGGGGGTGG - Intronic
1078828145 11:14951353-14951375 TTGGCTAGCGTGTCTGGGGACGG + Intronic
1078883085 11:15472517-15472539 TTGGCAAGGGGGGCTGGGTGGGG - Intergenic
1079574121 11:21982025-21982047 TTGGCTCCCAGGGCTGCTGGAGG + Intergenic
1079753230 11:24224632-24224654 TTGGGTGGTGGGGTTGGGGGAGG + Intergenic
1080659863 11:34286923-34286945 GTGGTTGCCGGGGCTGGGGGAGG + Intronic
1081240872 11:40705348-40705370 GTGGCTTGAGGGGATGGGGGAGG - Intronic
1081274623 11:41133478-41133500 TTGGTTGGCGGGGGCGGGGGGGG - Intronic
1081621942 11:44623951-44623973 TTGGCCCAAGGGGCTGGGGCTGG + Intergenic
1081839357 11:46185279-46185301 TTGGCAGGTGGGGCTGGGGGTGG + Intergenic
1083774728 11:64888794-64888816 TGGGCTCAAGGAGCTGGGGGAGG + Intergenic
1083939703 11:65888972-65888994 GTAGCTCGTGGGGCTGGGGGTGG - Intergenic
1083990581 11:66243677-66243699 GTGGCTGGAGGGGCTGGGGGAGG - Exonic
1084195498 11:67522058-67522080 TTGGATTGTGGGGCTGGGTGGGG - Intronic
1084430478 11:69108059-69108081 TTGGATGGCGGGGCTGGGACAGG - Intergenic
1084462417 11:69303315-69303337 TTGGCTCCGGGGGCAGGGCGAGG + Intronic
1084519489 11:69654845-69654867 TTGTCTCGCGTGGTTGGAGGTGG - Intronic
1084711127 11:70844342-70844364 TTGGGTTGGGGGGCCGGGGGCGG + Intronic
1085090959 11:73713278-73713300 TTGGCTTTCAGGGCTGGGTGTGG + Intronic
1087406854 11:97741700-97741722 TGGGGTGGGGGGGCTGGGGGAGG - Intergenic
1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG + Exonic
1089369941 11:117948250-117948272 GTGGCTGGTGGGGCTGGGTGTGG + Intergenic
1089457728 11:118635070-118635092 GTGGCCCGCGGGGCCGGGGGAGG - Intronic
1090238611 11:125166481-125166503 CAGCCTCGCGGGGCTGGGAGTGG + Intronic
1090984968 11:131758265-131758287 TTAGCTAGCGGGGTTGGCGGGGG - Intronic
1091006288 11:131956592-131956614 GTGTCTCGGGGGGTTGGGGGTGG + Intronic
1091222136 11:133935939-133935961 GTGGCTCTTGGAGCTGGGGGAGG - Intronic
1094063819 12:26342483-26342505 TTGGGTCACGGCGGTGGGGGGGG + Intronic
1095752673 12:45729262-45729284 AGGGCAGGCGGGGCTGGGGGTGG - Intergenic
1096127672 12:49131477-49131499 TGGGCGCGCGGGGCCGGAGGAGG - Intergenic
1096210500 12:49761602-49761624 CTGGCTCGTGGGGGTAGGGGTGG + Intronic
1096792590 12:54054250-54054272 CAGGCTGGCGGGGCTGGGGACGG - Exonic
1097223065 12:57461677-57461699 TGGGCTCCCGGGGCGGGTGGGGG + Intronic
1097236802 12:57546220-57546242 TTGACTCACGGGGCAGGTGGAGG - Intronic
1097929426 12:65168211-65168233 TTGGGAGGCGGGGCGGGGGGCGG - Intergenic
1099665249 12:85619963-85619985 GTGGGCCGGGGGGCTGGGGGTGG + Intergenic
1101350762 12:103928256-103928278 TTGGCTCTCTGGGCTGGGAGCGG - Intergenic
1101583837 12:106067261-106067283 TGGGTCCGGGGGGCTGGGGGAGG + Exonic
1102046398 12:109832783-109832805 GTGGGTAGCGGGGGTGGGGGTGG - Intronic
1102275938 12:111581852-111581874 TTGGCTCTGGGGGCAGGGCGAGG - Intronic
1102601413 12:114033528-114033550 TTGTCTCCTGGGGCTTGGGGCGG - Intergenic
1103032004 12:117623373-117623395 TCGGGGTGCGGGGCTGGGGGAGG - Intronic
1103441610 12:120967083-120967105 TTCGGTCGCGGGGCTGGCTGAGG - Intergenic
1103565706 12:121814352-121814374 TGGGCTGGAGGGGGTGGGGGCGG - Exonic
1103962635 12:124618496-124618518 GTGGTTGCCGGGGCTGGGGGAGG - Intergenic
1104920292 12:132287061-132287083 GTGGCTCACGGGGGGGGGGGGGG - Intronic
1105011773 12:132761415-132761437 TTGGCTTCCCGGGCCGGGGGCGG - Intronic
1105407784 13:20145898-20145920 TTGGCAGGTGGGGCTGTGGGAGG - Intronic
1106303492 13:28490431-28490453 TTAGCTCACGGGGCTGCAGGGGG - Intronic
1108191130 13:47940141-47940163 GTGGCTTGGGGGGCAGGGGGCGG + Intronic
1110219470 13:73058740-73058762 TGGGCTGGCGGAGCCGGGGGCGG - Intronic
1112560249 13:100506370-100506392 TTCGCGGGCGGGGGTGGGGGCGG + Intronic
1112602424 13:100869406-100869428 TTGGCTGGAGGGGCTGGTGGTGG + Intergenic
1113066085 13:106375328-106375350 CTGGCTCACAGGGCTGGGGCTGG - Intergenic
1113793433 13:113042735-113042757 TTGGGTCACGGGTCTGGGGGAGG + Intronic
1117602476 14:57390298-57390320 TTGCCACGCGGGGCCGGGGAGGG - Intergenic
1117936035 14:60908463-60908485 TGGGGTCGGGGGGTTGGGGGAGG - Intronic
1118376819 14:65184655-65184677 CTGGCTCTTGGGGCTGGTGGGGG + Intergenic
1120880244 14:89410085-89410107 TGGGGACGCGGGGCTTGGGGAGG - Intronic
1121904058 14:97723629-97723651 GTGGCTTGCGGGGCTGCGGATGG + Intergenic
1122706472 14:103625144-103625166 CTGGCTGGAGGGGCTGGGGCGGG - Intronic
1124436883 15:29657470-29657492 TCGGCTGGGGGGGCGGGGGGGGG + Intergenic
1125200746 15:37099053-37099075 GTGGCTCGCGCGGCTCGGGGCGG - Intronic
1125492266 15:40157209-40157231 TTGGCTCAAGAGGCTGGGGTTGG + Intergenic
1125517616 15:40331376-40331398 TTTGCTGGAGGGGCGGGGGGTGG - Intergenic
1127547165 15:60002402-60002424 TGGGTGCGAGGGGCTGGGGGAGG - Intergenic
1128116046 15:65106234-65106256 ATGGCTGGCAGGGCTGGGGCAGG + Exonic
1128493239 15:68172055-68172077 TTGGGGTGGGGGGCTGGGGGAGG - Intronic
1129162331 15:73753461-73753483 CTCGCTGGCGGGGCTGGAGGCGG + Intergenic
1129686930 15:77691577-77691599 TTTGCTAGAGGGGCTGAGGGAGG - Intronic
1131136212 15:89937983-89938005 CTGGCTGGCCGGGCGGGGGGGGG - Intergenic
1131493443 15:92882640-92882662 TTGGCCCCCGGGCCTGCGGGCGG + Intergenic
1131828449 15:96338872-96338894 TTAGCTGGCCGGGCGGGGGGTGG + Exonic
1132036411 15:98488530-98488552 TTGGGTCAGGGGGCTGGGGAAGG + Intronic
1132217929 15:100081069-100081091 TTGGGTCAGGGGGCTGGGGAAGG + Intronic
1132236246 15:100224096-100224118 TTGGGTCAGGGGGCTGGGGAAGG - Intronic
1132480609 16:164771-164793 TGGGGTCGCGGGGCGGGGCGGGG + Intronic
1132566853 16:627503-627525 CTGGCCAGCGGGGCCGGGGGCGG + Exonic
1132610193 16:812027-812049 TGAGCTGGCAGGGCTGGGGGTGG + Intronic
1132619064 16:855845-855867 TGTGCTCTGGGGGCTGGGGGTGG + Intronic
1132628822 16:906343-906365 TTGGGTCAGGGGGCTGGGGAAGG + Intronic
1132724686 16:1333650-1333672 TCGGCGCGCGCGGCTGGGAGCGG + Intronic
1132850532 16:2023029-2023051 TGTTCTCGCGGGGCTGGCGGGGG + Intergenic
1132875589 16:2135617-2135639 GTGGCTCGGGGCGCTGGCGGGGG - Exonic
1133281819 16:4671066-4671088 TTTCCTCGTGGGGCTGGTGGTGG + Intronic
1134519397 16:14911736-14911758 GTGGCTCGGGGCGCTGGCGGGGG + Intronic
1134554536 16:15154492-15154514 GTGGCTCGGGGCGCTGGCGGGGG - Intergenic
1134707067 16:16310391-16310413 GTGGCTCGGGGCGCTGGCGGGGG + Intergenic
1134960473 16:18401733-18401755 GTGGCTCGGGGCGCTGGCGGGGG - Intergenic
1136181298 16:28554241-28554263 GGGGCTCGTGGGGGTGGGGGCGG + Intronic
1136228910 16:28875853-28875875 AAGGCTGGCAGGGCTGGGGGAGG - Intergenic
1136414662 16:30095996-30096018 CTGGGGCGCGGGGGTGGGGGCGG + Exonic
1136626669 16:31465998-31466020 GTGCCTTGCGGGGTTGGGGGAGG + Intronic
1137026921 16:35486177-35486199 TGGGCTCGGGGGGCAGGGGTGGG - Intergenic
1137029386 16:35507361-35507383 GTGGCTCCAGGGGCTGGGGCAGG - Intergenic
1137382612 16:48013004-48013026 TTAGCTTGGGGGGCAGGGGGCGG + Intergenic
1138399017 16:56730518-56730540 TGGGCTCGCGGGGCACGAGGTGG - Intronic
1138489990 16:57371226-57371248 TTGGGTGGGGGGGCGGGGGGGGG + Intergenic
1138552040 16:57753534-57753556 TGGGGACGCTGGGCTGGGGGCGG - Intronic
1138579438 16:57930842-57930864 GTGGCTGCCGGGGCTGGGGTGGG + Intronic
1139821794 16:69726764-69726786 AAGTCTCTCGGGGCTGGGGGAGG + Exonic
1139846376 16:69924576-69924598 TTGGCTGGAGGGGGTGTGGGGGG + Intronic
1139950149 16:70664574-70664596 CAGGCCCGCGGGGCTGGGGTGGG - Intronic
1140481082 16:75263244-75263266 TTACCTGGCAGGGCTGGGGGTGG + Intronic
1141495902 16:84409299-84409321 TAGGGTCAGGGGGCTGGGGGAGG + Intronic
1141683313 16:85556436-85556458 CTGGCTCGGGGGTCTGGCGGAGG - Intergenic
1141703292 16:85652036-85652058 TAGCCTCACGGGGCTGGGGTAGG + Intronic
1142049868 16:87951351-87951373 TGGGCGCGCGGGCCCGGGGGCGG - Intronic
1142115054 16:88352102-88352124 TGGGTGCGAGGGGCTGGGGGCGG + Intergenic
1142219033 16:88843971-88843993 GTGGCTGCCGGGGCTGGGGGTGG + Intronic
1143432263 17:6895656-6895678 TTGGCTGGCGGGGGGGGGGGGGG + Intronic
1143623004 17:8091666-8091688 TTGCCTTGCAGGGCTTGGGGTGG - Intergenic
1143625800 17:8109656-8109678 TGGCCCGGCGGGGCTGGGGGCGG + Intronic
1143915855 17:10292269-10292291 TTGGGTCATGGGGGTGGGGGTGG + Intergenic
1144757088 17:17686317-17686339 TGGGGTCGGGGGGCAGGGGGAGG + Intronic
1144760598 17:17704859-17704881 TTGGGTGGGGGGGCCGGGGGAGG + Intronic
1144856058 17:18268512-18268534 TTGCCTCGCGGGGAGGGGAGTGG - Intergenic
1144940166 17:18933323-18933345 CTGGCCCGCCGGGCTGGGGCAGG + Intergenic
1144952149 17:19000154-19000176 ATGGCTCCTGGGGCTAGGGGAGG + Intronic
1145205920 17:20984802-20984824 GTGGCTGGCCGGGCTGAGGGCGG - Intergenic
1145209291 17:21001359-21001381 TTAGCTGGCTGGGCTGGGGAGGG - Exonic
1145933405 17:28701543-28701565 TTCGATCATGGGGCTGGGGGAGG - Exonic
1145980115 17:29006062-29006084 TCGCCGAGCGGGGCTGGGGGCGG + Exonic
1146219941 17:31009098-31009120 CTGCCTCTCGGGGCTCGGGGAGG + Intergenic
1146786766 17:35728083-35728105 TTGCCTCCTGGAGCTGGGGGTGG - Intronic
1147044744 17:37744279-37744301 TTTCCCCGCGGGGCTGGGGCTGG - Intronic
1147168162 17:38604352-38604374 TGGGCTCCCCGAGCTGGGGGTGG - Intronic
1147168778 17:38606327-38606349 AAGGCTCTCGGGGCTGGGTGGGG + Intergenic
1147412632 17:40264714-40264736 TTGGCACGCCGCCCTGGGGGTGG - Exonic
1147736349 17:42641084-42641106 TTGGGTGGCGGGGCAGGGGGGGG + Intergenic
1148221039 17:45862123-45862145 TTGGGTGGCGGGGATGGGGTTGG + Intergenic
1148335699 17:46839674-46839696 TTGGCGGGGGGGACTGGGGGAGG - Intronic
1148591127 17:48817328-48817350 TTGGCTCGCTGGGCAAGGGTAGG - Intergenic
1148645915 17:49219685-49219707 GTGGGTGGCGAGGCTGGGGGAGG - Intronic
1148742732 17:49902018-49902040 CTGGCGCGCGGGGCAGGGGGCGG - Intergenic
1148756495 17:49975798-49975820 ATGGCCTGAGGGGCTGGGGGAGG + Intergenic
1148871429 17:50660791-50660813 TTGGCTCTCAGAGCTGGGAGGGG - Intronic
1149990228 17:61379070-61379092 TTGGACTGAGGGGCTGGGGGAGG + Intronic
1151456527 17:74229467-74229489 CTGGCAGGTGGGGCTGGGGGTGG - Intronic
1151670688 17:75570270-75570292 CTGGGTCCCGGGGCTGGGAGTGG + Intronic
1151921673 17:77161404-77161426 TTGAGCCGCGGGGATGGGGGTGG + Intronic
1152070429 17:78131470-78131492 TGTGCACGCTGGGCTGGGGGCGG - Exonic
1152077618 17:78168932-78168954 TCGGGGCGCGAGGCTGGGGGTGG - Intronic
1152640272 17:81446436-81446458 CTGGCTGCCGGGGCTGGGGGTGG - Intronic
1153585341 18:6615026-6615048 TTGCTTTGCGGGGTTGGGGGTGG - Intergenic
1154367704 18:13726485-13726507 GCGGCTGGCGGGGCCGGGGGCGG - Exonic
1155909007 18:31487144-31487166 TGGGCACGGGGGGCGGGGGGAGG + Intergenic
1158192058 18:54841146-54841168 TTGGGTGGCGGGGCGGTGGGGGG + Intronic
1160206416 18:76837131-76837153 GAGGCTTGCGGGGCGGGGGGGGG - Intronic
1160745332 19:708779-708801 GGGGCGCGCGGGGCGGGGGGCGG + Intergenic
1160831323 19:1106038-1106060 ATGGCTCGGGGGCCTGTGGGGGG + Intronic
1160984840 19:1833763-1833785 CGGGCTTCCGGGGCTGGGGGAGG - Intronic
1161024925 19:2032331-2032353 TGGGCTCTGGAGGCTGGGGGTGG + Intronic
1161406094 19:4092021-4092043 TTGGTTGGAAGGGCTGGGGGAGG + Intronic
1161545708 19:4878692-4878714 TTGGTTCCCGGGGCGGGGGAGGG + Intergenic
1161848864 19:6728425-6728447 ATGGCCCGCGAGGCTGGAGGGGG - Intronic
1162105456 19:8367203-8367225 TAGCCTGGCGGGGTTGGGGGCGG - Intronic
1162730403 19:12715220-12715242 GTGGGCCGCTGGGCTGGGGGTGG - Intronic
1163154516 19:15432579-15432601 CGGGCTCGGGGGGCTGGGCGGGG + Intronic
1163251575 19:16129021-16129043 TTGCCTGGCAGGGCTGGGAGCGG - Intronic
1163285144 19:16342110-16342132 TGGGTGCGAGGGGCTGGGGGAGG + Intergenic
1163374308 19:16921086-16921108 TGAGCTCCTGGGGCTGGGGGAGG + Intronic
1164480437 19:28607487-28607509 TTGTCTGGCGGGGGTGAGGGTGG + Intergenic
1165157217 19:33796038-33796060 GCGGCGCCCGGGGCTGGGGGCGG - Intronic
1165470313 19:35999624-35999646 GTGGCGAGCGGGGTTGGGGGCGG - Intergenic
1165597885 19:37026163-37026185 TTAGCTGGCGGGGGTGGGGTTGG + Intronic
1165925010 19:39321109-39321131 GAGGCCGGCGGGGCTGGGGGTGG - Intergenic
1167019184 19:46861346-46861368 GGGGCCCGGGGGGCTGGGGGGGG - Intergenic
1167147794 19:47693625-47693647 TTGGCTGGATGGGCTGGTGGGGG + Intronic
1167353301 19:48989189-48989211 ATGGCTCACTGGGCTGGGCGCGG + Intronic
1167551319 19:50162923-50162945 TTGGGCAGCGGGGCTGGGCGAGG - Intronic
924998450 2:385225-385247 GTGGCTGGCTGGGCTGGAGGGGG - Intergenic
925020247 2:562925-562947 TGGGCCTGCGGGGCTGTGGGGGG + Intergenic
925156553 2:1652599-1652621 TGGCCTCTCGTGGCTGGGGGCGG - Intronic
925343850 2:3155708-3155730 ATGGCAGGCGGGGCTTGGGGGGG + Intergenic
925440982 2:3884860-3884882 TTTGTTGGCGGGGGTGGGGGGGG + Intergenic
926205618 2:10832915-10832937 GTGGCTGGGGGGGCGGGGGGTGG - Intronic
927619220 2:24634714-24634736 TTGTCTCCGGGGGCGGGGGGGGG - Intronic
927641422 2:24847966-24847988 GAGGCTCGCGGGGCAGGAGGAGG + Intronic
927864358 2:26579211-26579233 TGGGCACGTGGGGCTGTGGGTGG + Intronic
927881563 2:26693162-26693184 ACGGCTCGCCGGGCGGGGGGCGG + Intronic
928135042 2:28681691-28681713 TGGGCACTTGGGGCTGGGGGTGG + Intergenic
928373381 2:30757127-30757149 ATCGCCCGTGGGGCTGGGGGTGG - Intronic
929531345 2:42755005-42755027 TTGGCTTGGGGCGCTGAGGGTGG + Exonic
929562136 2:42962526-42962548 CTGGCTGGAGGGGTTGGGGGAGG + Intergenic
929916325 2:46138956-46138978 TTGGCTCTTGGCACTGGGGGAGG + Intronic
929932327 2:46268351-46268373 GTGGCTCCAGGGGCTGGGGGAGG + Intergenic
929978924 2:46661070-46661092 TGGGCAAGCGGGGCTGGGCGTGG - Intergenic
930124348 2:47783890-47783912 TTGGTGGGCGGGGCGGGGGGCGG + Intronic
932608934 2:73184293-73184315 TGGCGGCGCGGGGCTGGGGGTGG + Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
933703540 2:85273321-85273343 CTGGATGGCGGGGATGGGGGAGG - Intronic
933728175 2:85437970-85437992 TGGGGGCGGGGGGCTGGGGGCGG + Intergenic
933977320 2:87521969-87521991 TTGGCTAGAGGTGCTGGGTGGGG - Intergenic
934045441 2:88169862-88169884 ATGGGCCGCGGGGCTGGGCGCGG + Intergenic
934948252 2:98557849-98557871 TTGGCAGGCGGGGGTGGAGGGGG - Intronic
935196491 2:100819798-100819820 TTGGGCGCCGGGGCTGGGGGAGG - Intergenic
935777656 2:106487318-106487340 CTGGGTCGGGGAGCTGGGGGGGG - Intergenic
936316502 2:111428836-111428858 TTGGCTAGAGGTGCTGGGTGGGG + Intergenic
936375073 2:111933862-111933884 TGGGGTGGGGGGGCTGGGGGAGG - Intronic
937119632 2:119432421-119432443 TTGGGGTGCTGGGCTGGGGGTGG + Intronic
937920048 2:127122447-127122469 TTGGCAGGCAGGGCTGGGGCTGG - Intergenic
938919946 2:135985765-135985787 TTGGCTCTGGGGGCGGGGGCAGG + Intronic
940573769 2:155472879-155472901 GTGGGTTGCGGGGCTGGGGAGGG + Intergenic
940759096 2:157718221-157718243 TTGGACCTCGGGGCTGGGTGCGG + Intergenic
940974150 2:159924715-159924737 TTTACTCTGGGGGCTGGGGGGGG + Intergenic
941096664 2:161245093-161245115 TTGGCGCCCGGGGTCGGGGGAGG + Intergenic
942744662 2:179217979-179218001 GGGGGTTGCGGGGCTGGGGGAGG + Intronic
944582111 2:201140117-201140139 TGGGCTGGGTGGGCTGGGGGCGG + Intronic
946149014 2:217751504-217751526 TTGGCTCTAGGGACTTGGGGAGG + Intronic
946347817 2:219125430-219125452 CTGGCTCGCAGGGGTGGAGGAGG - Intronic
946636375 2:221732363-221732385 TTGGCTAGGAGAGCTGGGGGAGG - Intergenic
947623623 2:231605789-231605811 TTGGCCTGTTGGGCTGGGGGAGG - Intergenic
947807502 2:232978680-232978702 GTGGTTGCCGGGGCTGGGGGCGG - Intronic
948353468 2:237359600-237359622 TTGGCTCCCTGGGCCGGCGGGGG + Intronic
948599202 2:239098585-239098607 TTGGCTCGTGGGCCTGAGGCAGG - Intronic
1168818849 20:760241-760263 TTTGCTGGTGGGGCTGGGGAAGG - Exonic
1170756955 20:19213034-19213056 GGGGCTCCCGGGGCTGGGCGCGG + Intronic
1171186322 20:23126658-23126680 CAGGCTCCCGGGGGTGGGGGCGG - Intergenic
1172485472 20:35295335-35295357 TGGGCGCCAGGGGCTGGGGGAGG - Intergenic
1172793579 20:37522564-37522586 TGGGCGGGCGGGGCAGGGGGTGG + Intronic
1173737736 20:45373703-45373725 CTAGCTCGCGGAGGTGGGGGAGG + Exonic
1173803824 20:45911451-45911473 ATGGCGAGCGGGCCTGGGGGTGG + Exonic
1174306310 20:49616534-49616556 TTTGCTGGGGGGGTTGGGGGGGG - Intergenic
1175905711 20:62378402-62378424 TGGGCTCGGGGAGGTGGGGGTGG + Intergenic
1176035394 20:63033878-63033900 TGGGGTCACGGGGCTGGGGGTGG + Intergenic
1176281596 20:64316661-64316683 TTGGGGCGCGGGGGTTGGGGAGG + Intergenic
1176549303 21:8214501-8214523 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176557196 21:8258724-8258746 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176568235 21:8397539-8397561 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1176576138 21:8441759-8441781 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1177669700 21:24209081-24209103 TGGGCTGGCGAGGCTGGGGCCGG - Intergenic
1179344846 21:40546895-40546917 TTTGCTCCAGGGGCTGGGGCTGG + Intronic
1179474673 21:41635578-41635600 TTGGCTGTGGGGGCTGGGGGTGG - Intergenic
1179920690 21:44505578-44505600 GTGGGTGCCGGGGCTGGGGGGGG - Intronic
1180962217 22:19767091-19767113 TTGGCCCTCGGGGCCGGGGAAGG - Exonic
1181283532 22:21736166-21736188 TCGGCCGGCGGGGCTGGCGGTGG + Intergenic
1182593409 22:31399481-31399503 CTGGCTCGCGGGACGGGGCGGGG + Intergenic
1182686192 22:32122890-32122912 TTGGCTCAGGGGGCGGGGGCAGG + Intergenic
1182772452 22:32805064-32805086 GTGGCTGGCAGGGCTGAGGGGGG + Intronic
1182796404 22:32994461-32994483 ATGGCTGGAGGGGCTGGGGGTGG - Intronic
1182979246 22:34652714-34652736 TAGGGTCTCAGGGCTGGGGGTGG + Intergenic
1182994699 22:34801414-34801436 TTGGCTGGCGGGGCCGGGCGGGG + Intergenic
1183016748 22:34994723-34994745 CTGGGTCTGGGGGCTGGGGGTGG + Intergenic
1183099309 22:35574278-35574300 TGGGCTTGAGGGGCTGGGAGGGG - Intergenic
1183341244 22:37283137-37283159 TTGGCCCCCGGGGGTTGGGGTGG + Intronic
1183526443 22:38325991-38326013 CAGGCTGGCAGGGCTGGGGGCGG - Intronic
1183564194 22:38601431-38601453 GTGGCTCACAGGGGTGGGGGCGG + Intronic
1184349851 22:43936410-43936432 TTGGCACACTGGGCTGGGGGAGG - Intronic
1184445776 22:44545929-44545951 TTGGCTGGAGAGGCAGGGGGAGG + Intergenic
1184781765 22:46653231-46653253 CTGGCTCCCGGGGCAGCGGGCGG - Intronic
1184783549 22:46660869-46660891 TTGGCTGGAGGGGCTGGGTGTGG + Intronic
1184992494 22:48180348-48180370 CTAGCTCCCGGGCCTGGGGGCGG - Intergenic
1185151267 22:49165016-49165038 TTGGCTGGCGGGGTTGGGAGGGG - Intergenic
1185195348 22:49466001-49466023 GTGGGGTGCGGGGCTGGGGGAGG - Intronic
1185252394 22:49811224-49811246 GTGGCTGCCAGGGCTGGGGGAGG + Intronic
1185369714 22:50455454-50455476 GTGGCGCGTGGGGCTGGGGTGGG - Intronic
1203254188 22_KI270733v1_random:130817-130839 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203262244 22_KI270733v1_random:175896-175918 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
949490263 3:4582343-4582365 TGGGGTGGCGGGGGTGGGGGAGG - Intronic
949938612 3:9136414-9136436 GTGGCGCGCGGGGCGGGGCGGGG - Intronic
950171623 3:10842849-10842871 TTCTCTGGCGGGGCTGGGGCTGG + Intronic
950427579 3:12932796-12932818 CTGGCTGGCGGTGCTGCGGGAGG - Intronic
950478953 3:13232956-13232978 TGGGTGCCCGGGGCTGGGGGAGG + Intergenic
951208252 3:19946990-19947012 TTTGTTCGCGGGGCGGGGCGAGG - Intronic
952882236 3:37991972-37991994 TTGGCTCTACGGGCTGGGGCTGG + Intronic
953146183 3:40277345-40277367 ATGGGCTGCGGGGCTGGGGGAGG + Intergenic
953410746 3:42689250-42689272 GGGGCTCCCAGGGCTGGGGGAGG + Intronic
953800006 3:46015724-46015746 TTGGGGGGCGGGGGTGGGGGAGG - Intergenic
953846445 3:46430881-46430903 TTGGGAGGCGGTGCTGGGGGAGG - Intergenic
954474624 3:50732253-50732275 TTGGGTGGTGGGGCTGGGGCAGG + Intronic
955387232 3:58489398-58489420 TTGGTTTGGGGGGTTGGGGGTGG - Intergenic
960595192 3:119401959-119401981 ATGCCTCCCGGGGCTGAGGGTGG + Exonic
960986809 3:123286227-123286249 TTGGCTGCTGGGGCTGGGGGAGG + Intronic
961814656 3:129543327-129543349 TGGGCTCGCAGGGATGAGGGAGG - Intronic
963605639 3:147410056-147410078 TCGGCTGGCGAGGGTGGGGGGGG + Exonic
966402561 3:179562746-179562768 TTGGGTTGCGGAGCTGGAGGGGG - Intergenic
966911941 3:184564660-184564682 TTGGTGCAGGGGGCTGGGGGTGG + Intronic
966932635 3:184685738-184685760 CAGGCTCTTGGGGCTGGGGGAGG + Intergenic
967150976 3:186650156-186650178 TTTGTTGGCGGGGGTGGGGGGGG + Intronic
968918726 4:3511485-3511507 GTGGCTGGTGGGGCGGGGGGTGG - Exonic
969421184 4:7097094-7097116 GTGGGTGTCGGGGCTGGGGGAGG + Intergenic
969514319 4:7638115-7638137 TGAGCTGGCCGGGCTGGGGGCGG + Intronic
969718587 4:8880612-8880634 TCGGCTTGTGGGGCTGTGGGGGG - Intergenic
972311978 4:37890774-37890796 ATGGCCCGCGGGCTTGGGGGCGG + Intergenic
972738237 4:41866067-41866089 TTAGCTCGCTGCGCTGGGGTTGG - Intergenic
972827736 4:42780446-42780468 TTGGCTTTGGGGGCTTGGGGTGG - Intergenic
979523860 4:121697166-121697188 TGGTCTCGCGGGCCTGGGTGGGG + Intergenic
980285777 4:130776944-130776966 TTGCCTCGCTTGGCTGGGGGAGG - Intergenic
981279363 4:142939460-142939482 TTCTGTTGCGGGGCTGGGGGTGG + Intergenic
981745630 4:148049827-148049849 TTGGGTGGGGGGGCGGGGGGCGG + Intronic
983884645 4:172966680-172966702 TTGACTCCCTGGGCTGGGCGCGG - Intronic
985478812 5:94471-94493 GTGGGTGGCGGGGCTGGAGGGGG + Intergenic
985478845 5:94584-94606 GTGGCTGGCGGGGCTGGAGGGGG + Intergenic
985883830 5:2660536-2660558 TTGGATTCCGGGGCTGAGGGTGG + Intergenic
985896035 5:2750701-2750723 TTCACTCGCGGGGCTCAGGGCGG - Intronic
985936523 5:3101790-3101812 GAGGCTCCAGGGGCTGGGGGAGG - Intergenic
986636134 5:9823980-9824002 TTGCCTTGGAGGGCTGGGGGAGG + Intergenic
986783225 5:11085980-11086002 ATGGCTTGCTGGGCTGGGGAGGG + Intronic
987065015 5:14281428-14281450 TTGGATCACGGGGCGGGGGGGGG - Intronic
987732959 5:21800749-21800771 TTGGCTCATGGGAGTGGGGGTGG + Intronic
988780945 5:34521478-34521500 TGGGCTCTCGGGGCGGGAGGGGG - Intergenic
990235573 5:53763740-53763762 TGGGGGTGCGGGGCTGGGGGAGG + Intergenic
990509960 5:56481130-56481152 CGGGCGCGCGGGGCTGGGGGCGG - Intronic
992124840 5:73629205-73629227 TTGGCTGGCCAGGGTGGGGGTGG + Intronic
992417401 5:76565242-76565264 ATGGCACGAGGGGCTGGGGCTGG - Intronic
993655765 5:90576255-90576277 GTGGGGCGGGGGGCTGGGGGAGG - Intronic
994483740 5:100369019-100369041 GGGGCTTGGGGGGCTGGGGGAGG - Intergenic
995065707 5:107859552-107859574 TTAGCTTGGGGGGGTGGGGGTGG - Exonic
996329310 5:122311915-122311937 GGGGCTCGCTGGCCTGGGGGCGG + Intronic
997209298 5:132068139-132068161 TTGCCTCCTGGGGCTGGGGTGGG + Intergenic
998374116 5:141680218-141680240 TGGGCTTGCGGGGCTGGGCTGGG + Exonic
998433591 5:142088054-142088076 TTGGCATGCTGGGGTGGGGGAGG - Intergenic
998658118 5:144205196-144205218 CAGGCGCGCGGGGCTTGGGGCGG - Intronic
999533110 5:152484238-152484260 TTGGGTGGGGGGGCTAGGGGAGG + Intergenic
1000052659 5:157575836-157575858 GAGGCCCGCGGGGCTGGAGGCGG - Intergenic
1000357985 5:160419156-160419178 TTTCCTGGCGGGGCCGGGGGCGG + Exonic
1000990147 5:167903518-167903540 TTGGGTGGCTGGGGTGGGGGTGG + Intronic
1001432012 5:171669970-171669992 CTGGGTGGCGGGGGTGGGGGTGG - Intergenic
1001634870 5:173202678-173202700 TTGGGAAGCTGGGCTGGGGGAGG + Intergenic
1001653214 5:173329629-173329651 GGGGCTCGCAGGGCTGGGGGAGG + Intergenic
1002099491 5:176850415-176850437 TTGGGTGGTGGGGCCGGGGGTGG + Intronic
1002349907 5:178576710-178576732 CTGGCGCGCGGGGCCCGGGGAGG - Intronic
1002350164 5:178577546-178577568 CTGGCGCGCGGGGCCTGGGGAGG + Intronic
1002487771 5:179551061-179551083 CAGGCACGCGGGGCTGCGGGGGG - Intronic
1003524362 6:6885766-6885788 AAGGGTCACGGGGCTGGGGGAGG - Intergenic
1003577591 6:7312616-7312638 TGAGCGCGAGGGGCTGGGGGTGG + Intronic
1004403437 6:15310092-15310114 TTGGCTGGATGGGCTGGGGCTGG + Intronic
1005999429 6:30953827-30953849 TTGGCTTGCTGGGTTGTGGGTGG + Exonic
1006052284 6:31354430-31354452 TGGGGTGGCGGGTCTGGGGGTGG - Intronic
1006335029 6:33415955-33415977 TTGTCTCCTGGGACTGGGGGAGG + Exonic
1007111245 6:39314474-39314496 TTGGATCCCAGGGCTGGGTGGGG - Exonic
1007161140 6:39792566-39792588 ATGCCCCGCGGGGCTTGGGGAGG + Intronic
1007236118 6:40392364-40392386 TTGGGGCGCGGGGCGGAGGGTGG + Exonic
1008296794 6:49787632-49787654 TAGGTTTGCGGGGGTGGGGGTGG - Intergenic
1009054121 6:58315094-58315116 TGGGCTCAGGGGGCTGGGGGAGG + Intergenic
1009237001 6:61135464-61135486 TGGGGTTGGGGGGCTGGGGGAGG - Intergenic
1009679161 6:66869919-66869941 ATGGGTTGTGGGGCTGGGGGAGG - Intergenic
1011195458 6:84774830-84774852 TGGACTCGCCGGGCTGCGGGCGG + Intergenic
1012056643 6:94420618-94420640 TTGGGGTGAGGGGCTGGGGGAGG + Intergenic
1013585212 6:111572294-111572316 TGGGCTTGCAGGGCTGGGTGAGG + Intronic
1013709995 6:112885941-112885963 TGGGGGCGGGGGGCTGGGGGAGG + Intergenic
1015431307 6:133132787-133132809 TTGGGCCCCGGGGCTGGGGCTGG - Intergenic
1017970866 6:159311680-159311702 TTGGCTGTCACGGCTGGGGGAGG + Intergenic
1018397313 6:163388271-163388293 TTGTCTCTCTGGGCTGGGTGTGG - Intergenic
1018876751 6:167827532-167827554 CGCGCTCGCGGGGGTGGGGGCGG - Intronic
1019206826 6:170368806-170368828 CTGTCTGCCGGGGCTGGGGGGGG + Intronic
1019338627 7:496884-496906 TTGTCTCGTGGGCCTGGAGGTGG + Intergenic
1019372456 7:670156-670178 ATGGCACGTGGGGCTGGGCGCGG - Intronic
1019427638 7:984888-984910 TTGCCTGGCGGGGCTGGCTGGGG + Intronic
1019689608 7:2403435-2403457 CTGGCTCGCGAGGGCGGGGGCGG + Intergenic
1019711388 7:2519688-2519710 TTGGCTCCCGGGCTCGGGGGCGG - Intronic
1019923867 7:4179842-4179864 TTGGCCCCCATGGCTGGGGGTGG + Intronic
1019972126 7:4549730-4549752 TTGGCAGGCTGGGCTGGGGAGGG - Intergenic
1021716950 7:23469655-23469677 GGGGGGCGCGGGGCTGGGGGAGG - Intronic
1021969249 7:25950986-25951008 GAGGCTCCCGGGGTTGGGGGCGG + Intergenic
1021969353 7:25951364-25951386 CGGCCGCGCGGGGCTGGGGGCGG + Intergenic
1022102166 7:27175080-27175102 TGGGCTGGCGGGACTGGGGGTGG + Intronic
1022475653 7:30707824-30707846 GTGGCTGGTGGGGCTGGGTGGGG + Intronic
1023158831 7:37278131-37278153 TTTTTTGGCGGGGCTGGGGGTGG + Intronic
1023264648 7:38392673-38392695 CTGGCCTGCGGGGCTGGGCGTGG - Intronic
1025004187 7:55342604-55342626 TTGGCTCCCGGGGCTGGCCCTGG - Intergenic
1025259096 7:57405173-57405195 GTGGCTCCCTGGGCTGGAGGAGG - Intergenic
1025723583 7:64037754-64037776 TTATTTCGCAGGGCTGGGGGCGG - Intronic
1026025435 7:66740664-66740686 TTCGCTGGCGGTGCCGGGGGCGG + Intronic
1026527923 7:71171960-71171982 TTGGATAGGTGGGCTGGGGGTGG - Intronic
1026869687 7:73842643-73842665 TTGGCTGGCGGGGGGGGGGGGGG - Intergenic
1027056468 7:75053106-75053128 GTGGTGCACGGGGCTGGGGGTGG + Intronic
1029344326 7:99967405-99967427 AAGTCTCCCGGGGCTGGGGGTGG - Intronic
1032002008 7:128271685-128271707 TGGCCCCGCGGGGCTGGTGGTGG + Intergenic
1032059262 7:128710203-128710225 TTGTCTAGCAGGGCTGGGTGTGG - Intronic
1032947657 7:136870815-136870837 TTGGCTCGCGGCGCCTGGGCTGG - Intronic
1033413921 7:141145759-141145781 TTGCCTTCAGGGGCTGGGGGTGG + Intronic
1034306018 7:150046345-150046367 TTGGGTCGGGGGGGGGGGGGCGG - Intergenic
1034330693 7:150279690-150279712 TTGGCCTGCAGAGCTGGGGGTGG - Intronic
1034405944 7:150902539-150902561 GTGGCTCCTGGGGATGGGGGTGG - Intergenic
1034667350 7:152830159-152830181 TTGGCCTGCAGAGCTGGGGGTGG + Intronic
1034984710 7:155501988-155502010 TTGGGTCGGGGGGGTTGGGGGGG + Exonic
1035600679 8:895031-895053 GTGGCTGGCAGGGCTGGGGTGGG + Intergenic
1036765651 8:11547872-11547894 TGGGGTCACAGGGCTGGGGGTGG + Intronic
1038444961 8:27596818-27596840 CTGTCTCGGGGGGCGGGGGGGGG + Intergenic
1038761200 8:30385037-30385059 CTGGGGCGCGGGGCTGGGCGAGG - Exonic
1040610573 8:48978010-48978032 TGGGCCAGCGGGGCTGGGGCGGG + Intergenic
1041104974 8:54433009-54433031 CTGGCTGCCAGGGCTGGGGGCGG + Intergenic
1042200474 8:66275867-66275889 GTGACTCCGGGGGCTGGGGGAGG - Intergenic
1044038682 8:87337690-87337712 TTGCCTCCCTTGGCTGGGGGTGG + Intronic
1045037146 8:98184631-98184653 TTGGCTTGGGGGTCTCGGGGTGG - Intergenic
1045510751 8:102810554-102810576 TGGGAACGCGGTGCTGGGGGCGG + Intergenic
1045522799 8:102917715-102917737 TTATCTCGGGGGGCGGGGGGTGG + Intronic
1045573952 8:103398136-103398158 TTGGCTAGAGGGGATGGGTGAGG - Intergenic
1047579100 8:126193049-126193071 TTGGGTGGCGGGGAGGGGGGGGG + Intergenic
1048172580 8:132121844-132121866 TTAGCTCTCGGGGCTTGGTGTGG - Exonic
1048998559 8:139809730-139809752 TTGGCTCTTGTGGCTGGGAGAGG - Intronic
1049073870 8:140378304-140378326 TTGACTCGGTGGGCTGGGAGAGG + Intronic
1050749962 9:8925561-8925583 TTGGTTGGCGGGGGTGGTGGGGG - Intronic
1051079491 9:13278963-13278985 TGGTGTCGGGGGGCTGGGGGTGG - Intronic
1051483025 9:17579407-17579429 TTGGCTTGCGAGGCGGGGCGCGG - Intronic
1051844640 9:21438015-21438037 GTGGCTCCAGGGGCTGGAGGAGG - Intronic
1053119981 9:35539111-35539133 ATGGCTCAGGGAGCTGGGGGAGG + Intronic
1056402652 9:86242967-86242989 GTGGCCTGCGGGGCTGGGCGTGG - Intronic
1056579534 9:87880776-87880798 GTGGTTGGCGGGGCGGGGGGGGG + Intergenic
1057152838 9:92809513-92809535 GTGGATCGCGGGTTTGGGGGTGG + Intergenic
1058705825 9:107637477-107637499 CAGGCTCGCTGGGCTGGGGCTGG - Intergenic
1058956229 9:109951235-109951257 TTGGTTGGTGGGGGTGGGGGTGG + Intronic
1059191610 9:112333083-112333105 ATGGTGCGCGGCGCTGGGGGAGG - Intronic
1060942283 9:127549908-127549930 GAGGCTGGCGGGGCTGGGAGGGG - Intronic
1061163932 9:128911646-128911668 TTGGCGGGAGGAGCTGGGGGTGG - Intronic
1061666411 9:132162980-132163002 TTGGCCGTCTGGGCTGGGGGCGG + Intronic
1062349899 9:136133457-136133479 TCCGGGCGCGGGGCTGGGGGCGG - Intergenic
1062358205 9:136175066-136175088 TGGGCTAGAGGGGCTGGGGCAGG + Intergenic
1062385513 9:136309472-136309494 TTGGCACCCAGGGCTGGGGCTGG - Intergenic
1062452576 9:136621742-136621764 TGGGCTCGTGGGGCTGGGTGGGG + Intergenic
1062501583 9:136854201-136854223 TTGGCCTGGGGGGCTGGGTGGGG - Exonic
1062535095 9:137017942-137017964 TGGGCGCCCGGGGCTGGGGCTGG - Intronic
1203470589 Un_GL000220v1:113961-113983 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1203478410 Un_GL000220v1:157933-157955 TGGGCGGGCGGGGCCGGGGGTGG + Intergenic
1186056374 X:5654053-5654075 TTGGCTCCGGGGGGGGGGGGCGG - Intergenic
1187172977 X:16869927-16869949 TTGGCGTGCGGAGCAGGGGGCGG - Intronic
1187569394 X:20485712-20485734 TTGGCACACAGGGATGGGGGTGG - Intergenic
1188006295 X:25017773-25017795 TGGGCTTTCGGGGCCGGGGGAGG - Intergenic
1188242603 X:27809416-27809438 GGGGCTGGCGGGGTTGGGGGGGG - Intronic
1189281290 X:39821468-39821490 TGGGAGCGCGGGGGTGGGGGAGG + Intergenic
1190246953 X:48696955-48696977 CTGGTGCGCGGGGCTGGGCGGGG + Intronic
1190711959 X:53077849-53077871 GTGGTTCGAGGGGCTGGGGCTGG - Exonic
1191858665 X:65648121-65648143 ATGGCTGGAGGGGGTGGGGGGGG + Intronic
1193318924 X:80097472-80097494 TTGGGTGGGGGGGCTGGGGGAGG + Intergenic
1196809956 X:119620985-119621007 TTGGGTGGTGGTGCTGGGGGTGG - Intronic
1199491336 X:148403662-148403684 TCGGGTGGCGGGGCGGGGGGGGG - Intergenic
1200147775 X:153935298-153935320 TCGGCAGGCGGGGGTGGGGGCGG + Exonic
1200218393 X:154378849-154378871 TTGGCTAGCGGCGTAGGGGGCGG - Intergenic
1200269157 X:154665274-154665296 GTGGGTTGGGGGGCTGGGGGAGG - Intergenic
1200281326 X:154779390-154779412 TGGCCTCTCTGGGCTGGGGGTGG - Intronic
1200985703 Y:9302523-9302545 GTGGGTTGCGGGGCTGGGGAGGG - Intergenic