ID: 1066470395

View in Genome Browser
Species Human (GRCh38)
Location 10:35692185-35692207
Sequence ATTTCTGAGAAGCGGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066470395_1066470400 -6 Left 1066470395 10:35692185-35692207 CCTTCCATCCGCTTCTCAGAAAT No data
Right 1066470400 10:35692202-35692224 AGAAATTTCAAGACCACCAGGGG No data
1066470395_1066470399 -7 Left 1066470395 10:35692185-35692207 CCTTCCATCCGCTTCTCAGAAAT No data
Right 1066470399 10:35692201-35692223 CAGAAATTTCAAGACCACCAGGG No data
1066470395_1066470398 -8 Left 1066470395 10:35692185-35692207 CCTTCCATCCGCTTCTCAGAAAT No data
Right 1066470398 10:35692200-35692222 TCAGAAATTTCAAGACCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066470395 Original CRISPR ATTTCTGAGAAGCGGATGGA AGG (reversed) Intergenic
No off target data available for this crispr