ID: 1066473694

View in Genome Browser
Species Human (GRCh38)
Location 10:35724244-35724266
Sequence CAAGGGTACTAGAGGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066473685_1066473694 29 Left 1066473685 10:35724192-35724214 CCTGTTAGAGAGACAGTAACTGC No data
Right 1066473694 10:35724244-35724266 CAAGGGTACTAGAGGAAAGCAGG No data
1066473684_1066473694 30 Left 1066473684 10:35724191-35724213 CCCTGTTAGAGAGACAGTAACTG No data
Right 1066473694 10:35724244-35724266 CAAGGGTACTAGAGGAAAGCAGG No data
1066473692_1066473694 -7 Left 1066473692 10:35724228-35724250 CCTGGTCAGAATTTGGCAAGGGT No data
Right 1066473694 10:35724244-35724266 CAAGGGTACTAGAGGAAAGCAGG No data
1066473688_1066473694 4 Left 1066473688 10:35724217-35724239 CCATGTGGACTCCTGGTCAGAAT No data
Right 1066473694 10:35724244-35724266 CAAGGGTACTAGAGGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066473694 Original CRISPR CAAGGGTACTAGAGGAAAGC AGG Intergenic
No off target data available for this crispr