ID: 1066477219

View in Genome Browser
Species Human (GRCh38)
Location 10:35759471-35759493
Sequence AAGGGCCTATTCAAATATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066477219_1066477224 5 Left 1066477219 10:35759471-35759493 CCCACATATTTGAATAGGCCCTT No data
Right 1066477224 10:35759499-35759521 ATGGTCCATGATTCAATATGAGG No data
1066477219_1066477226 16 Left 1066477219 10:35759471-35759493 CCCACATATTTGAATAGGCCCTT No data
Right 1066477226 10:35759510-35759532 TTCAATATGAGGAGATGAAAAGG No data
1066477219_1066477227 19 Left 1066477219 10:35759471-35759493 CCCACATATTTGAATAGGCCCTT No data
Right 1066477227 10:35759513-35759535 AATATGAGGAGATGAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066477219 Original CRISPR AAGGGCCTATTCAAATATGT GGG (reversed) Intergenic
No off target data available for this crispr