ID: 1066477891

View in Genome Browser
Species Human (GRCh38)
Location 10:35765315-35765337
Sequence CAGGCTGCACGGTGGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066477891_1066477900 9 Left 1066477891 10:35765315-35765337 CCGTCTTCCCACCGTGCAGCCTG No data
Right 1066477900 10:35765347-35765369 CCTGTCGCTTGCAGCCCCCTCGG No data
1066477891_1066477902 19 Left 1066477891 10:35765315-35765337 CCGTCTTCCCACCGTGCAGCCTG No data
Right 1066477902 10:35765357-35765379 GCAGCCCCCTCGGGACCTTCTGG No data
1066477891_1066477901 10 Left 1066477891 10:35765315-35765337 CCGTCTTCCCACCGTGCAGCCTG No data
Right 1066477901 10:35765348-35765370 CTGTCGCTTGCAGCCCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066477891 Original CRISPR CAGGCTGCACGGTGGGAAGA CGG (reversed) Intergenic
No off target data available for this crispr