ID: 1066478987

View in Genome Browser
Species Human (GRCh38)
Location 10:35777229-35777251
Sequence GTGGCTCACTTAGTGCCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066478987_1066478992 20 Left 1066478987 10:35777229-35777251 CCCGCAGGCACTAAGTGAGCCAC No data
Right 1066478992 10:35777272-35777294 TCAAGATGCTTGCTTGATGCAGG No data
1066478987_1066478993 21 Left 1066478987 10:35777229-35777251 CCCGCAGGCACTAAGTGAGCCAC No data
Right 1066478993 10:35777273-35777295 CAAGATGCTTGCTTGATGCAGGG No data
1066478987_1066478990 -5 Left 1066478987 10:35777229-35777251 CCCGCAGGCACTAAGTGAGCCAC No data
Right 1066478990 10:35777247-35777269 GCCACATGCTGTTGGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066478987 Original CRISPR GTGGCTCACTTAGTGCCTGC GGG (reversed) Intergenic