ID: 1066478988

View in Genome Browser
Species Human (GRCh38)
Location 10:35777230-35777252
Sequence TGTGGCTCACTTAGTGCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066478988_1066478993 20 Left 1066478988 10:35777230-35777252 CCGCAGGCACTAAGTGAGCCACA No data
Right 1066478993 10:35777273-35777295 CAAGATGCTTGCTTGATGCAGGG No data
1066478988_1066478990 -6 Left 1066478988 10:35777230-35777252 CCGCAGGCACTAAGTGAGCCACA No data
Right 1066478990 10:35777247-35777269 GCCACATGCTGTTGGAAAAATGG No data
1066478988_1066478992 19 Left 1066478988 10:35777230-35777252 CCGCAGGCACTAAGTGAGCCACA No data
Right 1066478992 10:35777272-35777294 TCAAGATGCTTGCTTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066478988 Original CRISPR TGTGGCTCACTTAGTGCCTG CGG (reversed) Intergenic
No off target data available for this crispr