ID: 1066478990

View in Genome Browser
Species Human (GRCh38)
Location 10:35777247-35777269
Sequence GCCACATGCTGTTGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066478987_1066478990 -5 Left 1066478987 10:35777229-35777251 CCCGCAGGCACTAAGTGAGCCAC No data
Right 1066478990 10:35777247-35777269 GCCACATGCTGTTGGAAAAATGG No data
1066478988_1066478990 -6 Left 1066478988 10:35777230-35777252 CCGCAGGCACTAAGTGAGCCACA No data
Right 1066478990 10:35777247-35777269 GCCACATGCTGTTGGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066478990 Original CRISPR GCCACATGCTGTTGGAAAAA TGG Intergenic