ID: 1066478991

View in Genome Browser
Species Human (GRCh38)
Location 10:35777248-35777270
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066478991_1066478993 2 Left 1066478991 10:35777248-35777270 CCACATGCTGTTGGAAAAATGGT No data
Right 1066478993 10:35777273-35777295 CAAGATGCTTGCTTGATGCAGGG No data
1066478991_1066478992 1 Left 1066478991 10:35777248-35777270 CCACATGCTGTTGGAAAAATGGT No data
Right 1066478992 10:35777272-35777294 TCAAGATGCTTGCTTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066478991 Original CRISPR ACCATTTTTCCAACAGCATG TGG (reversed) Intergenic