ID: 1066478991 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:35777248-35777270 |
| Sequence | ACCATTTTTCCAACAGCATG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1066478991_1066478993 | 2 | Left | 1066478991 | 10:35777248-35777270 | CCACATGCTGTTGGAAAAATGGT | No data | ||
| Right | 1066478993 | 10:35777273-35777295 | CAAGATGCTTGCTTGATGCAGGG | No data | ||||
| 1066478991_1066478992 | 1 | Left | 1066478991 | 10:35777248-35777270 | CCACATGCTGTTGGAAAAATGGT | No data | ||
| Right | 1066478992 | 10:35777272-35777294 | TCAAGATGCTTGCTTGATGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1066478991 | Original CRISPR | ACCATTTTTCCAACAGCATG TGG (reversed) | Intergenic | ||