ID: 1066478993

View in Genome Browser
Species Human (GRCh38)
Location 10:35777273-35777295
Sequence CAAGATGCTTGCTTGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066478987_1066478993 21 Left 1066478987 10:35777229-35777251 CCCGCAGGCACTAAGTGAGCCAC No data
Right 1066478993 10:35777273-35777295 CAAGATGCTTGCTTGATGCAGGG No data
1066478991_1066478993 2 Left 1066478991 10:35777248-35777270 CCACATGCTGTTGGAAAAATGGT No data
Right 1066478993 10:35777273-35777295 CAAGATGCTTGCTTGATGCAGGG No data
1066478988_1066478993 20 Left 1066478988 10:35777230-35777252 CCGCAGGCACTAAGTGAGCCACA No data
Right 1066478993 10:35777273-35777295 CAAGATGCTTGCTTGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066478993 Original CRISPR CAAGATGCTTGCTTGATGCA GGG Intergenic