ID: 1066479716

View in Genome Browser
Species Human (GRCh38)
Location 10:35783881-35783903
Sequence CTGAATAAACATTTGCACAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066479712_1066479716 -7 Left 1066479712 10:35783865-35783887 CCCCTTCCAAATCTGTCTGAATA No data
Right 1066479716 10:35783881-35783903 CTGAATAAACATTTGCACAACGG No data
1066479714_1066479716 -9 Left 1066479714 10:35783867-35783889 CCTTCCAAATCTGTCTGAATAAA No data
Right 1066479716 10:35783881-35783903 CTGAATAAACATTTGCACAACGG No data
1066479713_1066479716 -8 Left 1066479713 10:35783866-35783888 CCCTTCCAAATCTGTCTGAATAA No data
Right 1066479716 10:35783881-35783903 CTGAATAAACATTTGCACAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066479716 Original CRISPR CTGAATAAACATTTGCACAA CGG Intergenic
No off target data available for this crispr