ID: 1066482438

View in Genome Browser
Species Human (GRCh38)
Location 10:35809961-35809983
Sequence TACCCAAGAAAGCAGCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066482438_1066482440 -7 Left 1066482438 10:35809961-35809983 CCATTCTGCTGCTTTCTTGGGTA No data
Right 1066482440 10:35809977-35809999 TTGGGTATCAGGACAAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066482438 Original CRISPR TACCCAAGAAAGCAGCAGAA TGG (reversed) Intergenic
No off target data available for this crispr