ID: 1066488577

View in Genome Browser
Species Human (GRCh38)
Location 10:35872528-35872550
Sequence AAAGGCCAAGTGAAGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066488565_1066488577 26 Left 1066488565 10:35872479-35872501 CCAGGTAAAATCAGATCCATGTG No data
Right 1066488577 10:35872528-35872550 AAAGGCCAAGTGAAGTCTGAGGG No data
1066488573_1066488577 10 Left 1066488573 10:35872495-35872517 CCATGTGGGGAATGGAGGGGAAG No data
Right 1066488577 10:35872528-35872550 AAAGGCCAAGTGAAGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066488577 Original CRISPR AAAGGCCAAGTGAAGTCTGA GGG Intergenic
No off target data available for this crispr