ID: 1066491959

View in Genome Browser
Species Human (GRCh38)
Location 10:35902484-35902506
Sequence CTGTGTCTGGGGAAGTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066491951_1066491959 19 Left 1066491951 10:35902442-35902464 CCTGAACTTGCTTCGAAGCCCTG No data
Right 1066491959 10:35902484-35902506 CTGTGTCTGGGGAAGTTTGATGG No data
1066491954_1066491959 0 Left 1066491954 10:35902461-35902483 CCTGGCATCAGTGAGTTCTGAGG No data
Right 1066491959 10:35902484-35902506 CTGTGTCTGGGGAAGTTTGATGG No data
1066491953_1066491959 1 Left 1066491953 10:35902460-35902482 CCCTGGCATCAGTGAGTTCTGAG No data
Right 1066491959 10:35902484-35902506 CTGTGTCTGGGGAAGTTTGATGG No data
1066491950_1066491959 27 Left 1066491950 10:35902434-35902456 CCATTAAACCTGAACTTGCTTCG No data
Right 1066491959 10:35902484-35902506 CTGTGTCTGGGGAAGTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066491959 Original CRISPR CTGTGTCTGGGGAAGTTTGA TGG Intergenic
No off target data available for this crispr