ID: 1066497166

View in Genome Browser
Species Human (GRCh38)
Location 10:35953776-35953798
Sequence TATCTAATCCCTAACTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066497166_1066497168 -2 Left 1066497166 10:35953776-35953798 CCATTAAAGTTAGGGATTAGATA No data
Right 1066497168 10:35953797-35953819 TAGACAGATCAGACAAGGCAAGG No data
1066497166_1066497167 -7 Left 1066497166 10:35953776-35953798 CCATTAAAGTTAGGGATTAGATA No data
Right 1066497167 10:35953792-35953814 TTAGATAGACAGATCAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066497166 Original CRISPR TATCTAATCCCTAACTTTAA TGG (reversed) Intergenic
No off target data available for this crispr