ID: 1066497167

View in Genome Browser
Species Human (GRCh38)
Location 10:35953792-35953814
Sequence TTAGATAGACAGATCAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066497166_1066497167 -7 Left 1066497166 10:35953776-35953798 CCATTAAAGTTAGGGATTAGATA No data
Right 1066497167 10:35953792-35953814 TTAGATAGACAGATCAGACAAGG No data
1066497163_1066497167 9 Left 1066497163 10:35953760-35953782 CCTTATACTTTTTCTGCCATTAA No data
Right 1066497167 10:35953792-35953814 TTAGATAGACAGATCAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066497167 Original CRISPR TTAGATAGACAGATCAGACA AGG Intergenic
No off target data available for this crispr