ID: 1066497972

View in Genome Browser
Species Human (GRCh38)
Location 10:35960708-35960730
Sequence CTTCGCTGACCCTCTGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066497972_1066497980 19 Left 1066497972 10:35960708-35960730 CCTGCAACAGAGGGTCAGCGAAG No data
Right 1066497980 10:35960750-35960772 ATATTCCGAATGAGGAAGGCAGG No data
1066497972_1066497978 11 Left 1066497972 10:35960708-35960730 CCTGCAACAGAGGGTCAGCGAAG No data
Right 1066497978 10:35960742-35960764 AAGGAGGGATATTCCGAATGAGG No data
1066497972_1066497976 -5 Left 1066497972 10:35960708-35960730 CCTGCAACAGAGGGTCAGCGAAG No data
Right 1066497976 10:35960726-35960748 CGAAGGCTGGAAGAGAAAGGAGG No data
1066497972_1066497977 -4 Left 1066497972 10:35960708-35960730 CCTGCAACAGAGGGTCAGCGAAG No data
Right 1066497977 10:35960727-35960749 GAAGGCTGGAAGAGAAAGGAGGG No data
1066497972_1066497975 -8 Left 1066497972 10:35960708-35960730 CCTGCAACAGAGGGTCAGCGAAG No data
Right 1066497975 10:35960723-35960745 CAGCGAAGGCTGGAAGAGAAAGG No data
1066497972_1066497979 15 Left 1066497972 10:35960708-35960730 CCTGCAACAGAGGGTCAGCGAAG No data
Right 1066497979 10:35960746-35960768 AGGGATATTCCGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066497972 Original CRISPR CTTCGCTGACCCTCTGTTGC AGG (reversed) Intergenic
No off target data available for this crispr