ID: 1066503923

View in Genome Browser
Species Human (GRCh38)
Location 10:36022425-36022447
Sequence GAAAAGGCCCAGATGCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066503919_1066503923 12 Left 1066503919 10:36022390-36022412 CCAAGCTTTTGCTTAAGGTTCTG No data
Right 1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG No data
1066503917_1066503923 20 Left 1066503917 10:36022382-36022404 CCGAACTGCCAAGCTTTTGCTTA No data
Right 1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066503923 Original CRISPR GAAAAGGCCCAGATGCAGCA AGG Intergenic
No off target data available for this crispr