ID: 1066506513

View in Genome Browser
Species Human (GRCh38)
Location 10:36050264-36050286
Sequence GGATCCAACAATTCTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066506513_1066506519 20 Left 1066506513 10:36050264-36050286 CCCTCCTGAGAATTGTTGGATCC No data
Right 1066506519 10:36050307-36050329 GAGTTTGACACACACTGCTTTGG No data
1066506513_1066506517 -7 Left 1066506513 10:36050264-36050286 CCCTCCTGAGAATTGTTGGATCC No data
Right 1066506517 10:36050280-36050302 TGGATCCACTTAGAGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066506513 Original CRISPR GGATCCAACAATTCTCAGGA GGG (reversed) Intergenic
No off target data available for this crispr