ID: 1066506764

View in Genome Browser
Species Human (GRCh38)
Location 10:36053464-36053486
Sequence GTGACTTACCCAAGATCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066506759_1066506764 17 Left 1066506759 10:36053424-36053446 CCTTATTTCATAGATAAGAACAG No data
Right 1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG No data
1066506758_1066506764 18 Left 1066506758 10:36053423-36053445 CCCTTATTTCATAGATAAGAACA No data
Right 1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066506764 Original CRISPR GTGACTTACCCAAGATCACA TGG Intergenic
No off target data available for this crispr