ID: 1066508166

View in Genome Browser
Species Human (GRCh38)
Location 10:36066547-36066569
Sequence TGGTGCCCAAAGTTTCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066508166_1066508175 4 Left 1066508166 10:36066547-36066569 CCCCTCTGAAACTTTGGGCACCA No data
Right 1066508175 10:36066574-36066596 GCTCAGGGAGGGAGGCCCAGAGG No data
1066508166_1066508172 -7 Left 1066508166 10:36066547-36066569 CCCCTCTGAAACTTTGGGCACCA No data
Right 1066508172 10:36066563-36066585 GGCACCAATGAGCTCAGGGAGGG No data
1066508166_1066508171 -8 Left 1066508166 10:36066547-36066569 CCCCTCTGAAACTTTGGGCACCA No data
Right 1066508171 10:36066562-36066584 GGGCACCAATGAGCTCAGGGAGG No data
1066508166_1066508173 -4 Left 1066508166 10:36066547-36066569 CCCCTCTGAAACTTTGGGCACCA No data
Right 1066508173 10:36066566-36066588 ACCAATGAGCTCAGGGAGGGAGG No data
1066508166_1066508177 11 Left 1066508166 10:36066547-36066569 CCCCTCTGAAACTTTGGGCACCA No data
Right 1066508177 10:36066581-36066603 GAGGGAGGCCCAGAGGGCTGAGG No data
1066508166_1066508181 25 Left 1066508166 10:36066547-36066569 CCCCTCTGAAACTTTGGGCACCA No data
Right 1066508181 10:36066595-36066617 GGGCTGAGGATGGCTCTGCAAGG No data
1066508166_1066508176 5 Left 1066508166 10:36066547-36066569 CCCCTCTGAAACTTTGGGCACCA No data
Right 1066508176 10:36066575-36066597 CTCAGGGAGGGAGGCCCAGAGGG No data
1066508166_1066508178 15 Left 1066508166 10:36066547-36066569 CCCCTCTGAAACTTTGGGCACCA No data
Right 1066508178 10:36066585-36066607 GAGGCCCAGAGGGCTGAGGATGG No data
1066508166_1066508182 26 Left 1066508166 10:36066547-36066569 CCCCTCTGAAACTTTGGGCACCA No data
Right 1066508182 10:36066596-36066618 GGCTGAGGATGGCTCTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066508166 Original CRISPR TGGTGCCCAAAGTTTCAGAG GGG (reversed) Intergenic
No off target data available for this crispr