ID: 1066514741

View in Genome Browser
Species Human (GRCh38)
Location 10:36145418-36145440
Sequence GTGGATTCCCTGACAGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066514739_1066514741 -6 Left 1066514739 10:36145401-36145423 CCAAGTTCACAAAAGAGGTGGAT No data
Right 1066514741 10:36145418-36145440 GTGGATTCCCTGACAGAAATGGG No data
1066514736_1066514741 -4 Left 1066514736 10:36145399-36145421 CCCCAAGTTCACAAAAGAGGTGG No data
Right 1066514741 10:36145418-36145440 GTGGATTCCCTGACAGAAATGGG No data
1066514734_1066514741 9 Left 1066514734 10:36145386-36145408 CCTGGCATGTTTTCCCCAAGTTC No data
Right 1066514741 10:36145418-36145440 GTGGATTCCCTGACAGAAATGGG No data
1066514738_1066514741 -5 Left 1066514738 10:36145400-36145422 CCCAAGTTCACAAAAGAGGTGGA No data
Right 1066514741 10:36145418-36145440 GTGGATTCCCTGACAGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066514741 Original CRISPR GTGGATTCCCTGACAGAAAT GGG Intergenic
No off target data available for this crispr