ID: 1066518517

View in Genome Browser
Species Human (GRCh38)
Location 10:36190403-36190425
Sequence ATTCTCATGGGGCATGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066518508_1066518517 17 Left 1066518508 10:36190363-36190385 CCATTTAAACCCTTATCTGAGCT No data
Right 1066518517 10:36190403-36190425 ATTCTCATGGGGCATGAAATGGG No data
1066518512_1066518517 -7 Left 1066518512 10:36190387-36190409 CCTGCAAAATAAATAAATTCTCA No data
Right 1066518517 10:36190403-36190425 ATTCTCATGGGGCATGAAATGGG No data
1066518511_1066518517 -6 Left 1066518511 10:36190386-36190408 CCCTGCAAAATAAATAAATTCTC No data
Right 1066518517 10:36190403-36190425 ATTCTCATGGGGCATGAAATGGG No data
1066518510_1066518517 7 Left 1066518510 10:36190373-36190395 CCTTATCTGAGCTCCCTGCAAAA No data
Right 1066518517 10:36190403-36190425 ATTCTCATGGGGCATGAAATGGG No data
1066518509_1066518517 8 Left 1066518509 10:36190372-36190394 CCCTTATCTGAGCTCCCTGCAAA No data
Right 1066518517 10:36190403-36190425 ATTCTCATGGGGCATGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066518517 Original CRISPR ATTCTCATGGGGCATGAAAT GGG Intergenic
No off target data available for this crispr