ID: 1066519659

View in Genome Browser
Species Human (GRCh38)
Location 10:36201809-36201831
Sequence CTGAATCTACAGATCAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066519650_1066519659 22 Left 1066519650 10:36201764-36201786 CCAGTACCCACAAGATAACTTGC No data
Right 1066519659 10:36201809-36201831 CTGAATCTACAGATCAAGTTGGG No data
1066519652_1066519659 16 Left 1066519652 10:36201770-36201792 CCCACAAGATAACTTGCTTGGAT No data
Right 1066519659 10:36201809-36201831 CTGAATCTACAGATCAAGTTGGG No data
1066519653_1066519659 15 Left 1066519653 10:36201771-36201793 CCACAAGATAACTTGCTTGGATT No data
Right 1066519659 10:36201809-36201831 CTGAATCTACAGATCAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066519659 Original CRISPR CTGAATCTACAGATCAAGTT GGG Intergenic
No off target data available for this crispr