ID: 1066520950

View in Genome Browser
Species Human (GRCh38)
Location 10:36218291-36218313
Sequence TTGTTGAGATGTTGAGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066520949_1066520950 3 Left 1066520949 10:36218265-36218287 CCACTATCTTTTGTCTTTCATTA No data
Right 1066520950 10:36218291-36218313 TTGTTGAGATGTTGAGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066520950 Original CRISPR TTGTTGAGATGTTGAGAAAT AGG Intergenic
No off target data available for this crispr