ID: 1066523476

View in Genome Browser
Species Human (GRCh38)
Location 10:36249178-36249200
Sequence ATGCTTCCCTGGAAGATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066523468_1066523476 6 Left 1066523468 10:36249149-36249171 CCCACCCTAGGCTCATAGCTCAT No data
Right 1066523476 10:36249178-36249200 ATGCTTCCCTGGAAGATCTAAGG No data
1066523469_1066523476 5 Left 1066523469 10:36249150-36249172 CCACCCTAGGCTCATAGCTCATG No data
Right 1066523476 10:36249178-36249200 ATGCTTCCCTGGAAGATCTAAGG No data
1066523466_1066523476 11 Left 1066523466 10:36249144-36249166 CCAGCCCCACCCTAGGCTCATAG No data
Right 1066523476 10:36249178-36249200 ATGCTTCCCTGGAAGATCTAAGG No data
1066523472_1066523476 1 Left 1066523472 10:36249154-36249176 CCTAGGCTCATAGCTCATGGCCC No data
Right 1066523476 10:36249178-36249200 ATGCTTCCCTGGAAGATCTAAGG No data
1066523464_1066523476 26 Left 1066523464 10:36249129-36249151 CCAAAGCTATGCTATCCAGCCCC No data
Right 1066523476 10:36249178-36249200 ATGCTTCCCTGGAAGATCTAAGG No data
1066523471_1066523476 2 Left 1066523471 10:36249153-36249175 CCCTAGGCTCATAGCTCATGGCC No data
Right 1066523476 10:36249178-36249200 ATGCTTCCCTGGAAGATCTAAGG No data
1066523467_1066523476 7 Left 1066523467 10:36249148-36249170 CCCCACCCTAGGCTCATAGCTCA No data
Right 1066523476 10:36249178-36249200 ATGCTTCCCTGGAAGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066523476 Original CRISPR ATGCTTCCCTGGAAGATCTA AGG Intergenic
No off target data available for this crispr