ID: 1066531154

View in Genome Browser
Species Human (GRCh38)
Location 10:36340848-36340870
Sequence TCTCTGGCCCCTCGTTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066531154_1066531155 -10 Left 1066531154 10:36340848-36340870 CCTGGGAAACGAGGGGCCAGAGA No data
Right 1066531155 10:36340861-36340883 GGGCCAGAGAGATCTTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066531154 Original CRISPR TCTCTGGCCCCTCGTTTCCC AGG (reversed) Intergenic
No off target data available for this crispr