ID: 1066538072

View in Genome Browser
Species Human (GRCh38)
Location 10:36412904-36412926
Sequence TACTTTAAACAGATGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066538072_1066538076 3 Left 1066538072 10:36412904-36412926 CCATGCACCATCTGTTTAAAGTA No data
Right 1066538076 10:36412930-36412952 GTCTTTATTGTCCAGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066538072 Original CRISPR TACTTTAAACAGATGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr