ID: 1066539011

View in Genome Browser
Species Human (GRCh38)
Location 10:36423969-36423991
Sequence CTGATAAGTAGTAAATCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1066539011_1066539014 2 Left 1066539011 10:36423969-36423991 CCCGCTGATTTACTACTTATCAG No data
Right 1066539014 10:36423994-36424016 ATAAATTACAGTTTAGAACTTGG No data
1066539011_1066539015 16 Left 1066539011 10:36423969-36423991 CCCGCTGATTTACTACTTATCAG No data
Right 1066539015 10:36424008-36424030 AGAACTTGGATTTTTCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1066539011 Original CRISPR CTGATAAGTAGTAAATCAGC GGG (reversed) Intergenic
No off target data available for this crispr